EMAIL THIS PAGE TO A FRIEND

ENY2

enhancer of yellow 2 homolog (Drosophila)

57 Gene Product Result for
Synonyms: e(y)2
UniProtKB ID: Q9NPA8, B2RE52, G3V117
Gene ID:
Mouse(223527) enhancer of yellow 2 homolog (Drosophila)
Rat(685258) enhancer of yellow 2 homolog (Drosophila)
sheep(101117939) enhancer of yellow 2 homolog (Drosophila)
domestic guinea pig(100724441) enhancer of yellow 2 homolog (Drosophila)
naked mole-rat(101724196) enhancer of yellow 2 homolog (Drosophila)
Zebrafish(436700) enhancer of yellow 2 homolog (Drosophila)
domestic cat(101088907) enhancer of yellow 2 homolog (Drosophila)
cow(614069) enhancer of yellow 2 homolog (Drosophila)
dog(475074) enhancer of yellow 2 homolog (Drosophila)
chicken(420275) enhancer of yellow 2 homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020189 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004311 MISSION® esiRNA esiRNA targeting human ENY2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020189 Rosetta Predictions human pricing
NM_001130580 Rosetta Predictions rat pricing
NM_175009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110959 predicted 238
2 SASI_Hs01_00110960 predicted 236
3 SASI_Hs01_00110961 predicted 234
4 SASI_Hs01_00110962 predicted 287
5 SASI_Hs01_00110963 predicted 288
6 SASI_Hs01_00110964 predicted 231
7 SASI_Hs01_00110965 predicted 285
8 SASI_Hs01_00110966 predicted 259
9 SASI_Hs01_00110967 predicted 288
10 SASI_Hs01_00110968 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130580 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255969 predicted 701
2 SASI_Rn02_00255970 predicted 879
3 SASI_Rn02_00255971 predicted 818
4 SASI_Rn02_00255972 predicted 660
5 SASI_Rn02_00255973 predicted 274
6 SASI_Rn02_00255974 predicted 555
7 SASI_Rn02_00255975 predicted 919
8 SASI_Rn02_00255976 predicted 860
9 SASI_Rn02_00255977 predicted 299
10 SASI_Rn02_00255978 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124459 predicted 865
2 SASI_Mm01_00124460 predicted 704
3 SASI_Mm01_00124461 predicted 689
4 SASI_Mm01_00124464 predicted 490
5 SASI_Mm01_00124465 predicted 478
6 SASI_Mm01_00124466 predicted 758
7 SASI_Mm01_00124467 predicted 882
8 SASI_Mm01_00124468 predicted 845
9 SASI_Mm02_00345574 predicted 631
10 SASI_Mm02_00345575 predicted 548
11 SASI_Mm01_00124462 predicted 651
12 SASI_Mm01_00124463 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175009
VALIDATED
ENY2 MISSION shRNA Bacterial Glycerol Stock
enhancer of yellow 2 homolog (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175009.3-216s21c1
Sequence:CCGGAGAGTTGCTGAGAGCTAAATTCTCGAGAATTTAGCTCTCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175009.3-661s21c1
Sequence:CCGGTGCCTAGAAATGTTGAGATAACTCGAGTTATCTCAACATTTCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175009.3-821s21c1
Sequence:CCGGTTGTACTGTAGGTTGTCTATTCTCGAGAATAGACAACCTACAGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175009.3-864s21c1
Sequence:CCGGTTAGGACTGGGTCTTACTTAACTCGAGTTAAGTAAGACCCAGTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175009.3-387s21c1
Sequence:CCGGCCTACAGAGAATAAGAACATTCTCGAGAATGTTCTTATTCTCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175009.2-1651s1c1
Sequence:CCGGGCCAGCTATAAACTTGGATTACTCGAGTAATCCAAGTTTATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175009.2-258s1c1
Sequence:CCGGTCAGCTAAAGGCACACTGTAACTCGAGTTACAGTGTGCCTTTAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175009.2-387s1c1
Sequence:CCGGCCTACAGAGAATAAGAACATTCTCGAGAATGTTCTTATTCTCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175009.2-216s1c1
Sequence:CCGGAGAGTTGCTGAGAGCTAAATTCTCGAGAATTTAGCTCTCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175009
VALIDATED
ENY2 MISSION shRNA shRNA Plasmid DNA
enhancer of yellow 2 homolog (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175009.3-216s21c1
Sequence:CCGGAGAGTTGCTGAGAGCTAAATTCTCGAGAATTTAGCTCTCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175009.3-661s21c1
Sequence:CCGGTGCCTAGAAATGTTGAGATAACTCGAGTTATCTCAACATTTCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175009.3-821s21c1
Sequence:CCGGTTGTACTGTAGGTTGTCTATTCTCGAGAATAGACAACCTACAGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175009.3-864s21c1
Sequence:CCGGTTAGGACTGGGTCTTACTTAACTCGAGTTAAGTAAGACCCAGTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175009.3-387s21c1
Sequence:CCGGCCTACAGAGAATAAGAACATTCTCGAGAATGTTCTTATTCTCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175009.2-1651s1c1
Sequence:CCGGGCCAGCTATAAACTTGGATTACTCGAGTAATCCAAGTTTATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175009.2-258s1c1
Sequence:CCGGTCAGCTAAAGGCACACTGTAACTCGAGTTACAGTGTGCCTTTAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175009.2-387s1c1
Sequence:CCGGCCTACAGAGAATAAGAACATTCTCGAGAATGTTCTTATTCTCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175009.2-216s1c1
Sequence:CCGGAGAGTTGCTGAGAGCTAAATTCTCGAGAATTTAGCTCTCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175009
VALIDATED
ENY2 MISSION shRNA Lentiviral Transduction Particles
enhancer of yellow 2 homolog (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175009.3-216s21c1
Sequence:CCGGAGAGTTGCTGAGAGCTAAATTCTCGAGAATTTAGCTCTCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175009.3-661s21c1
Sequence:CCGGTGCCTAGAAATGTTGAGATAACTCGAGTTATCTCAACATTTCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175009.3-821s21c1
Sequence:CCGGTTGTACTGTAGGTTGTCTATTCTCGAGAATAGACAACCTACAGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175009.3-864s21c1
Sequence:CCGGTTAGGACTGGGTCTTACTTAACTCGAGTTAAGTAAGACCCAGTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175009.3-387s21c1
Sequence:CCGGCCTACAGAGAATAAGAACATTCTCGAGAATGTTCTTATTCTCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175009.2-1651s1c1
Sequence:CCGGGCCAGCTATAAACTTGGATTACTCGAGTAATCCAAGTTTATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175009.2-258s1c1
Sequence:CCGGTCAGCTAAAGGCACACTGTAACTCGAGTTACAGTGTGCCTTTAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175009.2-387s1c1
Sequence:CCGGCCTACAGAGAATAAGAACATTCTCGAGAATGTTCTTATTCTCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175009.2-216s1c1
Sequence:CCGGAGAGTTGCTGAGAGCTAAATTCTCGAGAATTTAGCTCTCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020189
VALIDATED
ENY2 MISSION shRNA Bacterial Glycerol Stock
enhancer of yellow 2 homolog (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-358s21c1
Sequence:CCGGCCAGCCTTTAAGATTGAATTACTCGAGTAATTCAATCTTAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020189.4-154s21c1
Sequence:CCGGAGTTGCTGAGAGCTAAATTAACTCGAGTTAATTTAGCTCTCAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-92s21c1
Sequence:CCGGGCAGATGAGAGCAGCGATTAACTCGAGTTAATCGCTGCTCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-204s21c1
Sequence:CCGGGCACACTGTAAAGAGGTAATTCTCGAGAATTACCTCTTTACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-377s21c1
Sequence:CCGGTAGATTGTGTTGTTGTGGTTTCTCGAGAAACCACAACAACACAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020189.4-262s1c1
Sequence:CCGGTGGTGGCTGAAATCACTCCAACTCGAGTTGGAGTGATTTCAGCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020189.4-319s1c1
Sequence:CCGGAGCTCCTACAAAGAATAAGAACTCGAGTTCTTATTCTTTGTAGGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020189
VALIDATED
ENY2 MISSION shRNA shRNA Plasmid DNA
enhancer of yellow 2 homolog (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-358s21c1
Sequence:CCGGCCAGCCTTTAAGATTGAATTACTCGAGTAATTCAATCTTAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020189.4-154s21c1
Sequence:CCGGAGTTGCTGAGAGCTAAATTAACTCGAGTTAATTTAGCTCTCAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-92s21c1
Sequence:CCGGGCAGATGAGAGCAGCGATTAACTCGAGTTAATCGCTGCTCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-204s21c1
Sequence:CCGGGCACACTGTAAAGAGGTAATTCTCGAGAATTACCTCTTTACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-377s21c1
Sequence:CCGGTAGATTGTGTTGTTGTGGTTTCTCGAGAAACCACAACAACACAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020189.4-262s1c1
Sequence:CCGGTGGTGGCTGAAATCACTCCAACTCGAGTTGGAGTGATTTCAGCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020189.4-319s1c1
Sequence:CCGGAGCTCCTACAAAGAATAAGAACTCGAGTTCTTATTCTTTGTAGGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020189
VALIDATED
ENY2 MISSION shRNA Lentiviral Transduction Particles
enhancer of yellow 2 homolog (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-358s21c1
Sequence:CCGGCCAGCCTTTAAGATTGAATTACTCGAGTAATTCAATCTTAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020189.4-154s21c1
Sequence:CCGGAGTTGCTGAGAGCTAAATTAACTCGAGTTAATTTAGCTCTCAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-92s21c1
Sequence:CCGGGCAGATGAGAGCAGCGATTAACTCGAGTTAATCGCTGCTCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-204s21c1
Sequence:CCGGGCACACTGTAAAGAGGTAATTCTCGAGAATTACCTCTTTACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020189.4-377s21c1
Sequence:CCGGTAGATTGTGTTGTTGTGGTTTCTCGAGAAACCACAACAACACAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020189.4-262s1c1
Sequence:CCGGTGGTGGCTGAAATCACTCCAACTCGAGTTGGAGTGATTTCAGCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020189.4-319s1c1
Sequence:CCGGAGCTCCTACAAAGAATAAGAACTCGAGTTCTTATTCTTTGTAGGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks