EMAIL THIS PAGE TO A FRIEND

EOGT

EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase

155 Gene Product Result for
Synonyms: AER61 AOS4 C3orf64 EOGT1
UniProtKB ID: Q5NDL2, Q6MZY0, Q6P985, Q6ZTV0
Gene ID:
Mouse(101351) EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Rat(494219) EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
fruit fly(33424) EGF-domain O-GlcNAc transferase
domestic cat(101089680) EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
cow(508782) chromosome 22 open reading frame, human C3orf64
dog(494221) glycosyltransferase AER61
sheep(101117114) EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
naked mole-rat(101715607) EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
domestic guinea pig(100731033) EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175313 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175313 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175313 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173654 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173654 Rosetta Predictions human pricing
NM_001009502 Rosetta Predictions rat pricing
NM_175313 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206244 predicted 1180
2 SASI_Hs01_00206245 predicted 962
3 SASI_Hs01_00206246 predicted 685
4 SASI_Hs01_00206247 predicted 1330
5 SASI_Hs01_00206248 predicted 1113
6 SASI_Hs01_00206249 predicted 1033
7 SASI_Hs01_00206250 predicted 1070
8 SASI_Hs01_00206251 predicted 426
9 SASI_Hs01_00206252 predicted 450
10 SASI_Hs02_00368558 predicted 1397
11 SASI_Hs01_00206253 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117817 predicted 1637
2 SASI_Rn01_00117818 predicted 1410
3 SASI_Rn01_00117819 predicted 901
4 SASI_Rn01_00117820 predicted 1263
5 SASI_Rn01_00117821 predicted 1212
6 SASI_Rn01_00117822 predicted 1308
7 SASI_Rn01_00117823 predicted 1839
8 SASI_Rn01_00117824 predicted 1028
9 SASI_Rn01_00117825 predicted 1207
10 SASI_Rn01_00117826 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105383 predicted 1087
2 SASI_Mm01_00105385 predicted 1253
3 SASI_Mm01_00105386 predicted 1749
4 SASI_Mm01_00105387 predicted 1161
5 SASI_Mm01_00105388 predicted 1073
6 SASI_Mm01_00105389 predicted 1282
7 SASI_Mm01_00105390 predicted 969
8 SASI_Mm02_00346079 predicted 2073
9 SASI_Mm01_00105391 predicted 1679
10 SASI_Mm01_00105392 predicted 705
11 SASI_Mm01_00105384 predicted 1593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175313
VALIDATED
EOGT MISSION shRNA Bacterial Glycerol Stock
EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175313.2-1510s1c1
Sequence:CCGGGCTGTCAGAATACAGGATTATCTCGAGATAATCCTGTATTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175313.4-1510s21c1
Sequence:CCGGCTGTCAGAATACAGGATTATTCTCGAGAATAATCCTGTATTCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175313.4-694s1c1
Sequence:CCGGGGATTCCCACTGTCCATATAACTCGAGTTATATGGACAGTGGGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175313.4-1219s1c1
Sequence:CCGGGAAATTAGATGCAGGTATTAACTCGAGTTAATACCTGCATCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175313.4-1751s21c1
Sequence:CCGGACGCACAACACGGACATATTTCTCGAGAAATATGTCCGTGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175313.4-694s21c1
Sequence:CCGGGGATTCCCACTGTCCATATAACTCGAGTTATATGGACAGTGGGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175313.4-2791s21c1
Sequence:CCGGTACGTTATAGACCAGTAATTACTCGAGTAATTACTGGTCTATAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175313.4-1219s21c1
Sequence:CCGGGAAATTAGATGCAGGTATTAACTCGAGTTAATACCTGCATCTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175313
VALIDATED
EOGT MISSION shRNA shRNA Plasmid DNA
EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175313.2-1510s1c1
Sequence:CCGGGCTGTCAGAATACAGGATTATCTCGAGATAATCCTGTATTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175313.4-1510s21c1
Sequence:CCGGCTGTCAGAATACAGGATTATTCTCGAGAATAATCCTGTATTCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175313.4-694s1c1
Sequence:CCGGGGATTCCCACTGTCCATATAACTCGAGTTATATGGACAGTGGGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175313.4-1219s1c1
Sequence:CCGGGAAATTAGATGCAGGTATTAACTCGAGTTAATACCTGCATCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175313.4-1751s21c1
Sequence:CCGGACGCACAACACGGACATATTTCTCGAGAAATATGTCCGTGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175313.4-694s21c1
Sequence:CCGGGGATTCCCACTGTCCATATAACTCGAGTTATATGGACAGTGGGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175313.4-2791s21c1
Sequence:CCGGTACGTTATAGACCAGTAATTACTCGAGTAATTACTGGTCTATAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175313.4-1219s21c1
Sequence:CCGGGAAATTAGATGCAGGTATTAACTCGAGTTAATACCTGCATCTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175313
VALIDATED
EOGT MISSION shRNA Lentiviral Transduction Particles
EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175313.2-1510s1c1
Sequence:CCGGGCTGTCAGAATACAGGATTATCTCGAGATAATCCTGTATTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175313.4-1510s21c1
Sequence:CCGGCTGTCAGAATACAGGATTATTCTCGAGAATAATCCTGTATTCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175313.4-694s1c1
Sequence:CCGGGGATTCCCACTGTCCATATAACTCGAGTTATATGGACAGTGGGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175313.4-1219s1c1
Sequence:CCGGGAAATTAGATGCAGGTATTAACTCGAGTTAATACCTGCATCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175313.4-1751s21c1
Sequence:CCGGACGCACAACACGGACATATTTCTCGAGAAATATGTCCGTGTTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175313.4-694s21c1
Sequence:CCGGGGATTCCCACTGTCCATATAACTCGAGTTATATGGACAGTGGGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175313.4-2791s21c1
Sequence:CCGGTACGTTATAGACCAGTAATTACTCGAGTAATTACTGGTCTATAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175313.4-1219s21c1
Sequence:CCGGGAAATTAGATGCAGGTATTAACTCGAGTTAATACCTGCATCTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173654
EOGT MISSION shRNA Bacterial Glycerol Stock
EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-535s1c1
Sequence:CCGGGAGGAGCACATTCCCTTCTTTCTCGAGAAAGAAGGGAATGTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-1395s1c1
Sequence:CCGGGATCACACACAACACGGACATCTCGAGATGTCCGTGTTGTGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-1693s1c1
Sequence:CCGGCAACACCCAAAGTGGCCATTTCTCGAGAAATGGCCACTTTGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-445s1c1
Sequence:CCGGGTCTCACTGAGTGGTCAGAATCTCGAGATTCTGACCACTCAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173654.1-2264s1c1
Sequence:CCGGGCCTTCTGGATTCAAGTGATTCTCGAGAATCACTTGAATCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-475s1c1
Sequence:CCGGCCTAATACTCACAGCATTCCACTCGAGTGGAATGCTGTGAGTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-871s1c1
Sequence:CCGGGCAACCAATCTCTATCTTGATCTCGAGATCAAGATAGAGATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173654.1-3066s1c1
Sequence:CCGGGCATGAAAGTATTCCAGTCTTCTCGAGAAGACTGGAATACTTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-916s1c1
Sequence:CCGGGACAGATTTAAGGAGGACTTTCTCGAGAAAGTCCTCCTTAAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-1051s1c1
Sequence:CCGGCAGCTCAACTTCAGACCTATACTCGAGTATAGGTCTGAAGTTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173654
EOGT MISSION shRNA shRNA Plasmid DNA
EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-535s1c1
Sequence:CCGGGAGGAGCACATTCCCTTCTTTCTCGAGAAAGAAGGGAATGTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-1395s1c1
Sequence:CCGGGATCACACACAACACGGACATCTCGAGATGTCCGTGTTGTGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-1693s1c1
Sequence:CCGGCAACACCCAAAGTGGCCATTTCTCGAGAAATGGCCACTTTGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-445s1c1
Sequence:CCGGGTCTCACTGAGTGGTCAGAATCTCGAGATTCTGACCACTCAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173654.1-2264s1c1
Sequence:CCGGGCCTTCTGGATTCAAGTGATTCTCGAGAATCACTTGAATCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-475s1c1
Sequence:CCGGCCTAATACTCACAGCATTCCACTCGAGTGGAATGCTGTGAGTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-871s1c1
Sequence:CCGGGCAACCAATCTCTATCTTGATCTCGAGATCAAGATAGAGATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173654.1-3066s1c1
Sequence:CCGGGCATGAAAGTATTCCAGTCTTCTCGAGAAGACTGGAATACTTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-916s1c1
Sequence:CCGGGACAGATTTAAGGAGGACTTTCTCGAGAAAGTCCTCCTTAAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-1051s1c1
Sequence:CCGGCAGCTCAACTTCAGACCTATACTCGAGTATAGGTCTGAAGTTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173654
EOGT MISSION shRNA Lentiviral Transduction Particles
EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-535s1c1
Sequence:CCGGGAGGAGCACATTCCCTTCTTTCTCGAGAAAGAAGGGAATGTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-1395s1c1
Sequence:CCGGGATCACACACAACACGGACATCTCGAGATGTCCGTGTTGTGTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-1693s1c1
Sequence:CCGGCAACACCCAAAGTGGCCATTTCTCGAGAAATGGCCACTTTGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-445s1c1
Sequence:CCGGGTCTCACTGAGTGGTCAGAATCTCGAGATTCTGACCACTCAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173654.1-2264s1c1
Sequence:CCGGGCCTTCTGGATTCAAGTGATTCTCGAGAATCACTTGAATCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173654.1-475s1c1
Sequence:CCGGCCTAATACTCACAGCATTCCACTCGAGTGGAATGCTGTGAGTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-871s1c1
Sequence:CCGGGCAACCAATCTCTATCTTGATCTCGAGATCAAGATAGAGATTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173654.1-3066s1c1
Sequence:CCGGGCATGAAAGTATTCCAGTCTTCTCGAGAAGACTGGAATACTTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-916s1c1
Sequence:CCGGGACAGATTTAAGGAGGACTTTCTCGAGAAAGTCCTCCTTAAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173654.1-1051s1c1
Sequence:CCGGCAGCTCAACTTCAGACCTATACTCGAGTATAGGTCTGAAGTTGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks