EMAIL THIS PAGE TO A FRIEND

EOMES

eomesodermin

58 Gene Product Result for
Synonyms: TBR2
UniProtKB ID: O95936, B7Z4I2, Q8TAZ2, Q9UPM7
Gene ID:
Human(8320) Summary: This gene belongs to the TBR1 (T-box brain protein 1) sub-family of T-box genes that share the common DNA-binding T-box domain. The encoded protein is a transcription factor which is crucial for embryonic development of mesoderm and the central nervous system in vertebrates. The protein may also be necessary for the differentiation of effector CD8+ T cells which are involved in defense against viral infections. A similar gene disrupted in mice is shown to be essential during trophoblast development and gastrulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(13813) eomesodermin homolog (Xenopus laevis)
Rat(316052) eomesodermin
chicken(428443) eomesodermin
Horse(100051187) eomesodermin
cow(511947) eomesodermin
dog(485636) eomesodermin
sheep(101103189) eomesodermin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005442 Rosetta Predictions human pricing
XM_001061749 Rosetta Predictions rat pricing
XM_001077231 Rosetta Predictions rat pricing
NM_010136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339597 predicted 915
2 SASI_Hs01_00148272 predicted 1827
3 SASI_Hs01_00148273 predicted 1474
4 SASI_Hs01_00148274 predicted 1114
5 SASI_Hs01_00148275 predicted 2046
6 SASI_Hs01_00148277 predicted 1894
7 SASI_Hs01_00148278 predicted 1318
8 SASI_Hs01_00148279 predicted 1307
9 SASI_Hs01_00148281 predicted 1196
10 SASI_Hs02_00339598 predicted 893
11 SASI_Hs01_00148276 predicted 1097
12 SASI_Hs01_00148280 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301234 predicted 1932
2 SASI_Rn02_00301235 predicted 1961
3 SASI_Rn02_00301236 predicted 1938
4 SASI_Rn02_00301237 predicted 1933
5 SASI_Rn02_00301238 predicted 2322
6 SASI_Rn02_00301239 predicted 2138
7 SASI_Rn02_00301240 predicted 1944
8 SASI_Rn02_00301241 predicted 2234
9 SASI_Rn02_00301242 predicted 2167
10 SASI_Rn02_00301243 predicted 2099
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356273 predicted 1485
2 SASI_Rn02_00356274 predicted 1877
3 SASI_Rn02_00356275 predicted 982
4 SASI_Rn02_00356276 predicted 700
5 SASI_Rn02_00356277 predicted 749
6 SASI_Rn02_00356278 predicted 858
7 SASI_Rn02_00356279 predicted 1690
8 SASI_Rn02_00356280 predicted 645
9 SASI_Rn02_00356281 predicted 1499
10 SASI_Rn02_00356282 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104439 predicted 1443
2 SASI_Mm01_00104440 predicted 1349
3 SASI_Mm01_00104441 predicted 2421
4 SASI_Mm01_00104442 predicted 2370
5 SASI_Mm01_00104443 predicted 1974
6 SASI_Mm01_00104444 predicted 1467
7 SASI_Mm01_00104445 predicted 2483
8 SASI_Mm01_00104446 predicted 2530
9 SASI_Mm01_00104447 predicted 2530
10 SASI_Mm01_00104448 predicted 1687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005442
EOMES MISSION shRNA Bacterial Glycerol Stock
eomesodermin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005442.2-2272s21c1
Sequence:CCGGATGGAAGACTTTAAGGTATTTCTCGAGAAATACCTTAAAGTCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005442.2-1125s21c1
Sequence:CCGGCAATAACAAAGGCGCAAATAACTCGAGTTATTTGCGCCTTTGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005442.2-2492s1c1
Sequence:CCGGCCGTTTCAGAAGGAGACATTTCTCGAGAAATGTCTCCTTCTGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-1154s1c1
Sequence:CCGGCCCAGATGATAGTCTTACAATCTCGAGATTGTAAGACTATCATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-931s1c1
Sequence:CCGGGCCCACTACAATGTGTTCGTACTCGAGTACGAACACATTGTAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-1583s1c1
Sequence:CCGGCCAACAAACTAGACATCAGTTCTCGAGAACTGATGTCTAGTTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-1970s1c1
Sequence:CCGGCCATAAAGTGTGAGGACATTACTCGAGTAATGTCCTCACACTTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005442
EOMES MISSION shRNA shRNA Plasmid DNA
eomesodermin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005442.2-2272s21c1
Sequence:CCGGATGGAAGACTTTAAGGTATTTCTCGAGAAATACCTTAAAGTCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005442.2-1125s21c1
Sequence:CCGGCAATAACAAAGGCGCAAATAACTCGAGTTATTTGCGCCTTTGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005442.2-2492s1c1
Sequence:CCGGCCGTTTCAGAAGGAGACATTTCTCGAGAAATGTCTCCTTCTGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-1154s1c1
Sequence:CCGGCCCAGATGATAGTCTTACAATCTCGAGATTGTAAGACTATCATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-931s1c1
Sequence:CCGGGCCCACTACAATGTGTTCGTACTCGAGTACGAACACATTGTAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-1583s1c1
Sequence:CCGGCCAACAAACTAGACATCAGTTCTCGAGAACTGATGTCTAGTTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-1970s1c1
Sequence:CCGGCCATAAAGTGTGAGGACATTACTCGAGTAATGTCCTCACACTTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005442
EOMES MISSION shRNA Lentiviral Transduction Particles
eomesodermin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005442.2-2272s21c1
Sequence:CCGGATGGAAGACTTTAAGGTATTTCTCGAGAAATACCTTAAAGTCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005442.2-1125s21c1
Sequence:CCGGCAATAACAAAGGCGCAAATAACTCGAGTTATTTGCGCCTTTGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005442.2-2492s1c1
Sequence:CCGGCCGTTTCAGAAGGAGACATTTCTCGAGAAATGTCTCCTTCTGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-1154s1c1
Sequence:CCGGCCCAGATGATAGTCTTACAATCTCGAGATTGTAAGACTATCATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-931s1c1
Sequence:CCGGGCCCACTACAATGTGTTCGTACTCGAGTACGAACACATTGTAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-1583s1c1
Sequence:CCGGCCAACAAACTAGACATCAGTTCTCGAGAACTGATGTCTAGTTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005442.2-1970s1c1
Sequence:CCGGCCATAAAGTGTGAGGACATTACTCGAGTAATGTCCTCACACTTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010136
EOMES MISSION shRNA Bacterial Glycerol Stock
eomesodermin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010136.3-2900s21c1
Sequence:CCGGACGAGTGCCCGGTGCTATTAACTCGAGTTAATAGCACCGGGCACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010136.3-2977s21c1
Sequence:CCGGGCTCTTATTTCTACTCATAAACTCGAGTTTATGAGTAGAAATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010136.1-2600s1c1
Sequence:CCGGCCACCTTTGATGTATCCTGTTCTCGAGAACAGGATACATCAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-1541s1c1
Sequence:CCGGGCAGGAGATTTCCTTTGGGAACTCGAGTTCCCAAAGGAAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-2418s1c1
Sequence:CCGGCCCATAAAGTGTGAGGACATTCTCGAGAATGTCCTCACACTTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-2048s1c1
Sequence:CCGGCGGTTCTTATGAATCTGAATACTCGAGTATTCAGATTCATAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-1571s1c1
Sequence:CCGGCACCAATAACAAAGGTGCAAACTCGAGTTTGCACCTTTGTTATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010136
EOMES MISSION shRNA shRNA Plasmid DNA
eomesodermin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010136.3-2900s21c1
Sequence:CCGGACGAGTGCCCGGTGCTATTAACTCGAGTTAATAGCACCGGGCACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010136.3-2977s21c1
Sequence:CCGGGCTCTTATTTCTACTCATAAACTCGAGTTTATGAGTAGAAATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010136.1-2600s1c1
Sequence:CCGGCCACCTTTGATGTATCCTGTTCTCGAGAACAGGATACATCAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-1541s1c1
Sequence:CCGGGCAGGAGATTTCCTTTGGGAACTCGAGTTCCCAAAGGAAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-2418s1c1
Sequence:CCGGCCCATAAAGTGTGAGGACATTCTCGAGAATGTCCTCACACTTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-2048s1c1
Sequence:CCGGCGGTTCTTATGAATCTGAATACTCGAGTATTCAGATTCATAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-1571s1c1
Sequence:CCGGCACCAATAACAAAGGTGCAAACTCGAGTTTGCACCTTTGTTATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010136
EOMES MISSION shRNA Lentiviral Transduction Particles
eomesodermin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010136.3-2900s21c1
Sequence:CCGGACGAGTGCCCGGTGCTATTAACTCGAGTTAATAGCACCGGGCACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010136.3-2977s21c1
Sequence:CCGGGCTCTTATTTCTACTCATAAACTCGAGTTTATGAGTAGAAATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010136.1-2600s1c1
Sequence:CCGGCCACCTTTGATGTATCCTGTTCTCGAGAACAGGATACATCAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-1541s1c1
Sequence:CCGGGCAGGAGATTTCCTTTGGGAACTCGAGTTCCCAAAGGAAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-2418s1c1
Sequence:CCGGCCCATAAAGTGTGAGGACATTCTCGAGAATGTCCTCACACTTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-2048s1c1
Sequence:CCGGCGGTTCTTATGAATCTGAATACTCGAGTATTCAGATTCATAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010136.1-1571s1c1
Sequence:CCGGCACCAATAACAAAGGTGCAAACTCGAGTTTGCACCTTTGTTATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks