EMAIL THIS PAGE TO A FRIEND

EP300

E1A binding protein p300

153 Gene Product Result for
Synonyms: KAT3B RSTS2 p300
UniProtKB ID: Q09472, B1AKC2
Gene ID:
Human(2033) Summary: This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
Mouse(328572) E1A binding protein p300
Rat(170915) E1A binding protein p300
chicken(418000) E1A binding protein p300
domestic cat(101088344) E1A binding protein p300
Horse(100055626) E1A binding protein p300
dog(100684945) E1A binding protein p300
sheep(101110136) E1A binding protein p300
naked mole-rat(101711512) E1A binding protein p300
domestic guinea pig(100734820) E1A binding protein p300
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003128 Anti-EP300 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA004112 Anti-EP300 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4500771 Anti-P300, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4500772 Anti-P300, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4503952 Anti-phospho-p300 (pSer89) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB1305651 ANTI-PHOSPHO-P300(S1834) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
WH0002033M2 Monoclonal Anti-EP300 antibody produced in mouse clone 1D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1400094 Monoclonal Anti-EP300 antibody produced in mouse clone 1B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403776 Monoclonal Anti-EP300 antibody produced in mouse clone 1D2, ascites fluid human
ELISA, western blot pricing
PLA0096 Rabbit anti-p300 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. chimpanzee, rhesus monkey, human, gorilla, primate
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001429 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001429 Rosetta Predictions human pricing
XM_001076610 Rosetta Predictions rat pricing
XM_576312 Rosetta Predictions rat pricing
NM_177821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052818 predicted 7628
2 SASI_Hs01_00052819 predicted 5571
3 SASI_Hs01_00052820 predicted 7575
4 SASI_Hs01_00052821 predicted 3230
5 SASI_Hs01_00052822 predicted 6596
6 SASI_Hs01_00052823 predicted 4290
7 SASI_Hs02_00331831 predicted 4893
8 SASI_Hs01_00052825 predicted 4571
9 SASI_Hs01_00052826 predicted 3692
10 SASI_Hs01_00052827 predicted 585
11 SASI_Hs01_00052824 predicted 5129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353873 predicted 7649
2 SASI_Rn02_00353874 predicted 5173
3 SASI_Rn02_00353875 predicted 2105
4 SASI_Rn02_00353876 predicted 6065
5 SASI_Rn02_00353877 predicted 601
6 SASI_Rn02_00353878 predicted 2150
7 SASI_Rn02_00353879 predicted 969
8 SASI_Rn02_00353880 predicted 3788
9 SASI_Rn02_00353881 predicted 4583
10 SASI_Rn02_00353882 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405039 predicted 920
2 SASI_Rn02_00405040 predicted 1147
3 SASI_Rn02_00405041 predicted 1031
4 SASI_Rn02_00405042 predicted 742
5 SASI_Rn02_00405043 predicted 889
6 SASI_Rn02_00405044 predicted 754
7 SASI_Rn02_00405045 predicted 653
8 SASI_Rn02_00405046 predicted 969
9 SASI_Rn02_00405047 predicted 656
10 SASI_Rn02_00405048 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159721 predicted 6626
2 SASI_Mm01_00159722 predicted 4327
3 SASI_Mm01_00159723 predicted 2103
4 SASI_Mm01_00159724 predicted 605
5 SASI_Mm01_00159725 predicted 971
6 SASI_Mm01_00159726 predicted 4585
7 SASI_Mm01_00159727 predicted 925
8 SASI_Mm01_00159728 predicted 6646
9 SASI_Mm01_00159729 predicted 1163
10 SASI_Mm02_00348281 predicted 2234
11 SASI_Mm01_00159730 predicted 1686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177821
EP300 MISSION shRNA Bacterial Glycerol Stock
E1A binding protein p300
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000071203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-747s1c1
Sequence:CCGGCCCTGGATTAAGTTTGATAAACTCGAGTTTATCAAACTTAATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-2293s1c1
Sequence:CCGGGCGGAATACTATCACCTCCTACTCGAGTAGGAGGTGATAGTATTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-2449s1c1
Sequence:CCGGCCAACAGGAATGACTACCAATCTCGAGATTGGTAGTCATTCCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-1945s1c1
Sequence:CCGGGCTAGTCCTATGGGTGTAAATCTCGAGATTTACACCCATAGGACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177821
EP300 MISSION shRNA shRNA Plasmid DNA
E1A binding protein p300
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000071203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-747s1c1
Sequence:CCGGCCCTGGATTAAGTTTGATAAACTCGAGTTTATCAAACTTAATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-2293s1c1
Sequence:CCGGGCGGAATACTATCACCTCCTACTCGAGTAGGAGGTGATAGTATTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-2449s1c1
Sequence:CCGGCCAACAGGAATGACTACCAATCTCGAGATTGGTAGTCATTCCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-1945s1c1
Sequence:CCGGGCTAGTCCTATGGGTGTAAATCTCGAGATTTACACCCATAGGACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177821
EP300 MISSION shRNA Lentiviral Transduction Particles
E1A binding protein p300
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000071203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-747s1c1
Sequence:CCGGCCCTGGATTAAGTTTGATAAACTCGAGTTTATCAAACTTAATCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-2293s1c1
Sequence:CCGGGCGGAATACTATCACCTCCTACTCGAGTAGGAGGTGATAGTATTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-2449s1c1
Sequence:CCGGCCAACAGGAATGACTACCAATCTCGAGATTGGTAGTCATTCCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177821.2-1945s1c1
Sequence:CCGGGCTAGTCCTATGGGTGTAAATCTCGAGATTTACACCCATAGGACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001429
VALIDATED
EP300 MISSION shRNA Bacterial Glycerol Stock
E1A binding protein p300
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001429.1-8874s1c1
Sequence:CCGGCCTCACTTTATGGAAGAGTTACTCGAGTAACTCTTCCATAAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_001429.1-7724s1c1
Sequence:CCGGGCCTTCACAATTCCGAGACATCTCGAGATGTCTCGGAATTGTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001429.1-3602s1c1
Sequence:CCGGCCCGGTGAACTCTCCTATAATCTCGAGATTATAGGAGAGTTCACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-559s21c1
Sequence:CCGGTAACCAATGGTGGTGATATTACTCGAGTAATATCACCACCATTGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-3367s21c1
Sequence:CCGGATACTCAGCCGGAGGATATTTCTCGAGAAATATCCTCCGGCTGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-3769s21c1
Sequence:CCGGTCAATAATGCCTGGTTATATACTCGAGTATATAACCAGGCATTATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-3950s21c1
Sequence:CCGGACCTCGTGATGCCACTTATTACTCGAGTAATAAGTGGCATCACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001429
VALIDATED
EP300 MISSION shRNA shRNA Plasmid DNA
E1A binding protein p300
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001429.1-8874s1c1
Sequence:CCGGCCTCACTTTATGGAAGAGTTACTCGAGTAACTCTTCCATAAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_001429.1-7724s1c1
Sequence:CCGGGCCTTCACAATTCCGAGACATCTCGAGATGTCTCGGAATTGTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001429.1-3602s1c1
Sequence:CCGGCCCGGTGAACTCTCCTATAATCTCGAGATTATAGGAGAGTTCACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-559s21c1
Sequence:CCGGTAACCAATGGTGGTGATATTACTCGAGTAATATCACCACCATTGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-3367s21c1
Sequence:CCGGATACTCAGCCGGAGGATATTTCTCGAGAAATATCCTCCGGCTGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-3769s21c1
Sequence:CCGGTCAATAATGCCTGGTTATATACTCGAGTATATAACCAGGCATTATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-3950s21c1
Sequence:CCGGACCTCGTGATGCCACTTATTACTCGAGTAATAAGTGGCATCACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001429
VALIDATED
EP300 MISSION shRNA Lentiviral Transduction Particles
E1A binding protein p300
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001429.1-8874s1c1
Sequence:CCGGCCTCACTTTATGGAAGAGTTACTCGAGTAACTCTTCCATAAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_001429.1-7724s1c1
Sequence:CCGGGCCTTCACAATTCCGAGACATCTCGAGATGTCTCGGAATTGTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001429.1-3602s1c1
Sequence:CCGGCCCGGTGAACTCTCCTATAATCTCGAGATTATAGGAGAGTTCACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-559s21c1
Sequence:CCGGTAACCAATGGTGGTGATATTACTCGAGTAATATCACCACCATTGGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-3367s21c1
Sequence:CCGGATACTCAGCCGGAGGATATTTCTCGAGAAATATCCTCCGGCTGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-3769s21c1
Sequence:CCGGTCAATAATGCCTGGTTATATACTCGAGTATATAACCAGGCATTATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001429.3-3950s21c1
Sequence:CCGGACCTCGTGATGCCACTTATTACTCGAGTAATAAGTGGCATCACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)