EMAIL THIS PAGE TO A FRIEND

EP400

E1A binding protein p400

88 Gene Product Result for
Synonyms: CAGH32 P400 TNRC12
Gene ID:
Mouse(75560) E1A binding protein p400
Rat(304569) E1A binding protein p400
chicken(416798) E1A binding protein p400
domestic cat(101098167) E1A binding protein p400
cow(538310) E1A binding protein p400
Horse(100062169) E1A binding protein p400
dog(486227) E1A binding protein p400
domestic guinea pig(100717037) E1A binding protein p400
naked mole-rat(101715887) E1A binding protein p400
sheep(101117449) E1A binding protein p400
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015409 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029337 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029337 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029337 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015409 Rosetta Predictions human pricing
NM_001107149 Rosetta Predictions rat pricing
NM_029337 Rosetta Predictions mouse pricing
NM_173066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347773 predicted 5856
2 SASI_Hs02_00347774 predicted 7233
3 SASI_Hs01_00018835 predicted 3990
4 SASI_Hs01_00018837 predicted 9454
5 SASI_Hs01_00018838 predicted 5555
6 SASI_Hs01_00018839 predicted 7185
7 SASI_Hs01_00018840 predicted 2740
8 SASI_Hs02_00347775 predicted 9259
9 SASI_Hs01_00018841 predicted 5180
10 SASI_Hs01_00018842 predicted 5810
11 SASI_Hs01_00018836 predicted 6505
12 SASI_Hs01_00018843 predicted 2818
13 SASI_Hs01_00018844 predicted 4018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225985 predicted 5889
2 SASI_Rn02_00225986 predicted 2771
3 SASI_Rn02_00225987 predicted 3978
4 SASI_Rn02_00225988 predicted 673
5 SASI_Rn02_00225989 predicted 4195
6 SASI_Rn02_00225990 predicted 7738
7 SASI_Rn02_00225991 predicted 3352
8 SASI_Rn02_00225992 predicted 3663
9 SASI_Rn02_00225993 predicted 2986
10 SASI_Rn02_00225994 predicted 5415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071088 predicted 3574
2 SASI_Mm01_00071090 predicted 4243
3 SASI_Mm02_00335170 predicted 7869
4 SASI_Mm01_00071091 predicted 4313
5 SASI_Mm02_00335171 predicted 5955
6 SASI_Mm01_00071092 predicted 5290
7 SASI_Mm02_00335172 predicted 7090
8 SASI_Mm01_00071094 predicted 6190
9 SASI_Mm01_00071095 predicted 5588
10 SASI_Mm01_00071096 predicted 3090
11 SASI_Mm01_00071089 predicted 6120
12 SASI_Mm01_00071093 predicted 6254
13 SASI_Mm01_00071097 predicted 5950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345114 predicted 3471
2 SASI_Mm02_00345115 predicted 4137
3 SASI_Mm02_00345116 predicted 7760
4 SASI_Mm02_00345117 predicted 4203
5 SASI_Mm02_00345118 predicted 5846
6 SASI_Mm02_00345119 predicted 5179
7 SASI_Mm02_00345120 predicted 6978
8 SASI_Mm02_00345121 predicted 6076
9 SASI_Mm02_00345122 predicted 5478
10 SASI_Mm02_00345123 predicted 2985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015409
VALIDATED
EP400 MISSION shRNA Bacterial Glycerol Stock
E1A binding protein p400
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015409.3-7326s21c1
Sequence:CCGGTCCGTACGAGCCAGATCTATGCTCGAGCATAGATCTGGCTCGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-3998s21c1
Sequence:CCGGGCCTTATACGAGGACGTTATCCTCGAGGATAACGTCCTCGTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-3222s21c1
Sequence:CCGGTCACAACCTCGGTCAAGTTTACTCGAGTAAACTTGACCGAGGTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-9577s21c1
Sequence:CCGGAGCACTGGGAAAGATATAATTCTCGAGAATTATATCTTTCCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-1249s21c1
Sequence:CCGGGGAGGTCTTCAAGGAGTATTTCTCGAGAAATACTCCTTGAAGACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-5920s21c1
Sequence:CCGGCAGCCGTACCACAGGTATAAACTCGAGTTTATACCTGTGGTACGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015409.2-4236s1c1
Sequence:CCGGGCGGAAACTCATGGAGGAAATCTCGAGATTTCCTCCATGAGTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015409.2-3161s1c1
Sequence:CCGGCGGTCAAGTTTAATGCTCCATCTCGAGATGGAGCATTAAACTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015409
VALIDATED
EP400 MISSION shRNA shRNA Plasmid DNA
E1A binding protein p400
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015409.3-7326s21c1
Sequence:CCGGTCCGTACGAGCCAGATCTATGCTCGAGCATAGATCTGGCTCGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-3998s21c1
Sequence:CCGGGCCTTATACGAGGACGTTATCCTCGAGGATAACGTCCTCGTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-3222s21c1
Sequence:CCGGTCACAACCTCGGTCAAGTTTACTCGAGTAAACTTGACCGAGGTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-9577s21c1
Sequence:CCGGAGCACTGGGAAAGATATAATTCTCGAGAATTATATCTTTCCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-1249s21c1
Sequence:CCGGGGAGGTCTTCAAGGAGTATTTCTCGAGAAATACTCCTTGAAGACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-5920s21c1
Sequence:CCGGCAGCCGTACCACAGGTATAAACTCGAGTTTATACCTGTGGTACGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015409.2-4236s1c1
Sequence:CCGGGCGGAAACTCATGGAGGAAATCTCGAGATTTCCTCCATGAGTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015409.2-3161s1c1
Sequence:CCGGCGGTCAAGTTTAATGCTCCATCTCGAGATGGAGCATTAAACTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015409
VALIDATED
EP400 MISSION shRNA Lentiviral Transduction Particles
E1A binding protein p400
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015409.3-7326s21c1
Sequence:CCGGTCCGTACGAGCCAGATCTATGCTCGAGCATAGATCTGGCTCGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-3998s21c1
Sequence:CCGGGCCTTATACGAGGACGTTATCCTCGAGGATAACGTCCTCGTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-3222s21c1
Sequence:CCGGTCACAACCTCGGTCAAGTTTACTCGAGTAAACTTGACCGAGGTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-9577s21c1
Sequence:CCGGAGCACTGGGAAAGATATAATTCTCGAGAATTATATCTTTCCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-1249s21c1
Sequence:CCGGGGAGGTCTTCAAGGAGTATTTCTCGAGAAATACTCCTTGAAGACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015409.3-5920s21c1
Sequence:CCGGCAGCCGTACCACAGGTATAAACTCGAGTTTATACCTGTGGTACGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015409.2-4236s1c1
Sequence:CCGGGCGGAAACTCATGGAGGAAATCTCGAGATTTCCTCCATGAGTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015409.2-3161s1c1
Sequence:CCGGCGGTCAAGTTTAATGCTCCATCTCGAGATGGAGCATTAAACTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029337
VALIDATED
EP400 MISSION shRNA Bacterial Glycerol Stock
E1A binding protein p400
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-7872s21c1
Sequence:CCGGTGCTACTTTCCAGTCCATTAACTCGAGTTAATGGACTGGAAAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029337.2-4136s21c1
Sequence:CCGGGTCGTCAGAAGGCCTTATATGCTCGAGCATATAAGGCCTTCTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-4720s21c1
Sequence:CCGGATAGCTCAGCTGGCGTCTATTCTCGAGAATAGACGCCAGCTGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-9548s21c1
Sequence:CCGGTACTTGGTAGGACTCCATATCCTCGAGGATATGGAGTCCTACCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-9031s21c2
Sequence:CCGGCCTCAAGTTGTGCAGCAACAACTCGAGTTGTTGCTGCACAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029337.1-3276s1c1
Sequence:CCGGCGGAAGAATCTCAATGGCATACTCGAGTATGCCATTGAGATTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029337.1-9536s1c1
Sequence:CCGGCCGTGAACATTAGCTTTGATTCTCGAGAATCAAAGCTAATGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029337.1-2704s1c1
Sequence:CCGGCCAGATTAAAGGGATTTGATACTCGAGTATCAAATCCCTTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029337.1-8841s1c1
Sequence:CCGGCCTCAAGTTGTGCAGCAACAACTCGAGTTGTTGCTGCACAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029337.1-6165s1c1
Sequence:CCGGGCTGACTTTATGGAACAGCTTCTCGAGAAGCTGTTCCATAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029337
VALIDATED
EP400 MISSION shRNA shRNA Plasmid DNA
E1A binding protein p400
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-7872s21c1
Sequence:CCGGTGCTACTTTCCAGTCCATTAACTCGAGTTAATGGACTGGAAAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029337.2-4136s21c1
Sequence:CCGGGTCGTCAGAAGGCCTTATATGCTCGAGCATATAAGGCCTTCTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-4720s21c1
Sequence:CCGGATAGCTCAGCTGGCGTCTATTCTCGAGAATAGACGCCAGCTGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-9548s21c1
Sequence:CCGGTACTTGGTAGGACTCCATATCCTCGAGGATATGGAGTCCTACCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-9031s21c2
Sequence:CCGGCCTCAAGTTGTGCAGCAACAACTCGAGTTGTTGCTGCACAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029337.1-3276s1c1
Sequence:CCGGCGGAAGAATCTCAATGGCATACTCGAGTATGCCATTGAGATTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029337.1-9536s1c1
Sequence:CCGGCCGTGAACATTAGCTTTGATTCTCGAGAATCAAAGCTAATGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029337.1-2704s1c1
Sequence:CCGGCCAGATTAAAGGGATTTGATACTCGAGTATCAAATCCCTTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029337.1-8841s1c1
Sequence:CCGGCCTCAAGTTGTGCAGCAACAACTCGAGTTGTTGCTGCACAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029337.1-6165s1c1
Sequence:CCGGGCTGACTTTATGGAACAGCTTCTCGAGAAGCTGTTCCATAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029337
VALIDATED
EP400 MISSION shRNA Lentiviral Transduction Particles
E1A binding protein p400
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-7872s21c1
Sequence:CCGGTGCTACTTTCCAGTCCATTAACTCGAGTTAATGGACTGGAAAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029337.2-4136s21c1
Sequence:CCGGGTCGTCAGAAGGCCTTATATGCTCGAGCATATAAGGCCTTCTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-4720s21c1
Sequence:CCGGATAGCTCAGCTGGCGTCTATTCTCGAGAATAGACGCCAGCTGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-9548s21c1
Sequence:CCGGTACTTGGTAGGACTCCATATCCTCGAGGATATGGAGTCCTACCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029337.2-9031s21c2
Sequence:CCGGCCTCAAGTTGTGCAGCAACAACTCGAGTTGTTGCTGCACAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029337.1-3276s1c1
Sequence:CCGGCGGAAGAATCTCAATGGCATACTCGAGTATGCCATTGAGATTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029337.1-9536s1c1
Sequence:CCGGCCGTGAACATTAGCTTTGATTCTCGAGAATCAAAGCTAATGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029337.1-2704s1c1
Sequence:CCGGCCAGATTAAAGGGATTTGATACTCGAGTATCAAATCCCTTTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029337.1-8841s1c1
Sequence:CCGGCCTCAAGTTGTGCAGCAACAACTCGAGTTGTTGCTGCACAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029337.1-6165s1c1
Sequence:CCGGGCTGACTTTATGGAACAGCTTCTCGAGAAGCTGTTCCATAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks