EMAIL THIS PAGE TO A FRIEND

EP400NL

EP400 N-terminal like

22 Gene Product Result for
Species: Human EP400NL(347918)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182613 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182613 Rosetta Predictions human pricing
NR_003290 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056369 predicted 867
2 SASI_Hs01_00056370 predicted 1174
3 SASI_Hs01_00056371 predicted 1113
4 SASI_Hs01_00056372 predicted 1973
5 SASI_Hs01_00056373 predicted 2004
6 SASI_Hs01_00056374 predicted 633
7 SASI_Hs01_00056375 predicted 1177
8 SASI_Hs01_00056376 predicted 1214
9 SASI_Hs01_00056377 predicted 1225
10 SASI_Hs01_00056378 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379127 predicted 744
2 SASI_Hs02_00379128 predicted 783
3 SASI_Hs02_00379129 predicted 922
4 SASI_Hs02_00379130 predicted 708
5 SASI_Hs02_00379131 predicted 755
6 SASI_Hs02_00379132 predicted 705
7 SASI_Hs02_00379133 predicted 759
8 SASI_Hs02_00379134 predicted 746
9 SASI_Hs02_00379135 predicted 822
10 SASI_Hs02_00379136 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182613
EP400NL MISSION shRNA Bacterial Glycerol Stock
EP400 N-terminal like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1261s1c1
Sequence:CCGGGCAACACTTTCAAGGGAACATCTCGAGATGTTCCCTTGAAAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182613.1-1370s1c1
Sequence:CCGGGAGGAGCACTTTGAAGTCATTCTCGAGAATGACTTCAAAGTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1564s1c1
Sequence:CCGGCCAGCGACCTAACAAATACATCTCGAGATGTATTTGTTAGGTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1328s1c1
Sequence:CCGGGCATATCTTAGGCAGAATGATCTCGAGATCATTCTGCCTAAGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182613.1-1325s1c1
Sequence:CCGGCAAGCATATCTTAGGCAGAATCTCGAGATTCTGCCTAAGATATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1295s1c1
Sequence:CCGGGCTTTCAAGGAGAGACTGTATCTCGAGATACAGTCTCTCCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182613.1-2044s1c1
Sequence:CCGGGCACTTGATTAGACTCCAGAACTCGAGTTCTGGAGTCTAATCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182613
EP400NL MISSION shRNA shRNA Plasmid DNA
EP400 N-terminal like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1261s1c1
Sequence:CCGGGCAACACTTTCAAGGGAACATCTCGAGATGTTCCCTTGAAAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182613.1-1370s1c1
Sequence:CCGGGAGGAGCACTTTGAAGTCATTCTCGAGAATGACTTCAAAGTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1564s1c1
Sequence:CCGGCCAGCGACCTAACAAATACATCTCGAGATGTATTTGTTAGGTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1328s1c1
Sequence:CCGGGCATATCTTAGGCAGAATGATCTCGAGATCATTCTGCCTAAGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182613.1-1325s1c1
Sequence:CCGGCAAGCATATCTTAGGCAGAATCTCGAGATTCTGCCTAAGATATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1295s1c1
Sequence:CCGGGCTTTCAAGGAGAGACTGTATCTCGAGATACAGTCTCTCCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182613.1-2044s1c1
Sequence:CCGGGCACTTGATTAGACTCCAGAACTCGAGTTCTGGAGTCTAATCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182613
EP400NL MISSION shRNA Lentiviral Transduction Particles
EP400 N-terminal like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1261s1c1
Sequence:CCGGGCAACACTTTCAAGGGAACATCTCGAGATGTTCCCTTGAAAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182613.1-1370s1c1
Sequence:CCGGGAGGAGCACTTTGAAGTCATTCTCGAGAATGACTTCAAAGTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1564s1c1
Sequence:CCGGCCAGCGACCTAACAAATACATCTCGAGATGTATTTGTTAGGTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1328s1c1
Sequence:CCGGGCATATCTTAGGCAGAATGATCTCGAGATCATTCTGCCTAAGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182613.1-1325s1c1
Sequence:CCGGCAAGCATATCTTAGGCAGAATCTCGAGATTCTGCCTAAGATATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182613.1-1295s1c1
Sequence:CCGGGCTTTCAAGGAGAGACTGTATCTCGAGATACAGTCTCTCCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182613.1-2044s1c1
Sequence:CCGGGCACTTGATTAGACTCCAGAACTCGAGTTCTGGAGTCTAATCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks