EMAIL THIS PAGE TO A FRIEND

EPAS1

endothelial PAS domain protein 1

168 Gene Product Result for
Synonyms: ECYT4 HIF2A HLF MOP2 PASD2 bHLHe73
UniProtKB ID: Q99814, Q86VA2, Q99630
Gene ID:
Human(2034) Summary: This gene encodes a transcription factor involved in the induction of genes regulated by oxygen, which is induced as oxygen levels fall. The encoded protein contains a basic-helix-loop-helix domain protein dimerization domain as well as a domain found in proteins in signal transduction pathways which respond to oxygen levels. Mutations in this gene are associated with erythrocytosis familial type 4. [provided by RefSeq, Nov 2009]
Mouse(13819) endothelial PAS domain protein 1
Rat(29452) endothelial PAS domain protein 1
sheep(100135446) endothelial PAS domain protein 1
naked mole-rat(101701434) endothelial PAS domain protein 1
domestic guinea pig(100726954) endothelial PAS domain protein 1
chicken(395596) endothelial PAS domain protein 1
cow(282711) endothelial PAS domain protein 1
dog(474578) endothelial PAS domain protein 1
Horse(100068622) endothelial PAS domain protein 1
domestic cat(101085621) endothelial PAS domain protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001430 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008751 MISSION® esiRNA esiRNA targeting human EPAS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001430 Rosetta Predictions human pricing
NM_023090 Rosetta Predictions rat pricing
NM_010137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019152 predicted 2750
2 SASI_Hs01_00019154 predicted 2751
3 SASI_Hs01_00019156 predicted 911
4 SASI_Hs01_00019157 predicted 2301
5 SASI_Hs01_00019158 predicted 1730
6 SASI_Hs01_00019159 predicted 1709
7 SASI_Hs01_00019160 predicted 1494
8 SASI_Hs01_00019161 predicted 1542
9 SASI_Hs02_00331832 predicted 3192
10 SASI_Hs02_00331833 predicted 845
11 SASI_Hs01_00019153 predicted 2765
12 SASI_Hs01_00019155 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030082 predicted 433
2 SASI_Rn01_00030083 predicted 1550
3 SASI_Rn01_00030084 predicted 1893
4 SASI_Rn02_00263720 predicted 1540
5 SASI_Rn02_00263721 predicted 668
6 SASI_Rn01_00030087 predicted 2004
7 SASI_Rn01_00030088 predicted 1078
8 SASI_Rn01_00030089 predicted 846
9 SASI_Rn01_00030090 predicted 1102
10 SASI_Rn02_00263722 predicted 1189
11 SASI_Rn01_00030081 predicted 472
12 SASI_Rn01_00030085 predicted 1024
13 SASI_Rn01_00030086 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144144 predicted 771
2 SASI_Mm01_00144145 predicted 799
3 SASI_Mm01_00144146 predicted 1640
4 SASI_Mm01_00144147 predicted 1354
5 SASI_Mm02_00317873 predicted 1895
6 SASI_Mm01_00144149 predicted 690
7 SASI_Mm01_00144150 predicted 1075
8 SASI_Mm02_00317874 predicted 1518
9 SASI_Mm01_00144151 predicted 1005
10 SASI_Mm01_00144152 predicted 738
11 SASI_Mm01_00144148 predicted 1380
12 SASI_Mm01_00144153 predicted 1391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010137
EPAS1 MISSION shRNA Bacterial Glycerol Stock
endothelial PAS domain protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-1155s1c1
Sequence:CCGGCGACAGAATCTTGGAACTGATCTCGAGATCAGTTCCAAGATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010137.2-3281s1c1
Sequence:CCGGCCTCCCTTGAATTACTTCTAACTCGAGTTAGAAGTAATTCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-2412s1c1
Sequence:CCGGGCCTCATGTCTCCATGTTCAACTCGAGTTGAACATGGAGACATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-811s1c1
Sequence:CCGGCGTGAGAACCTGACTCTCAAACTCGAGTTTGAGAGTCAGGTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-1156s1c1
Sequence:CCGGGACAGAATCTTGGAACTGATTCTCGAGAATCAGTTCCAAGATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010137.3-1426s21c1
Sequence:CCGGGTATCATGTGTGTCAACTATGCTCGAGCATAGTTGACACACATGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010137.3-3414s21c1
Sequence:CCGGAGGAAAGCTTTGGCGTCATTCCTCGAGGAATGACGCCAAAGCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010137.3-1864s21c1
Sequence:CCGGGCAGCCCTGAGGACTACTATTCTCGAGAATAGTAGTCCTCAGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010137
EPAS1 MISSION shRNA shRNA Plasmid DNA
endothelial PAS domain protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-1155s1c1
Sequence:CCGGCGACAGAATCTTGGAACTGATCTCGAGATCAGTTCCAAGATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010137.2-3281s1c1
Sequence:CCGGCCTCCCTTGAATTACTTCTAACTCGAGTTAGAAGTAATTCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-2412s1c1
Sequence:CCGGGCCTCATGTCTCCATGTTCAACTCGAGTTGAACATGGAGACATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-811s1c1
Sequence:CCGGCGTGAGAACCTGACTCTCAAACTCGAGTTTGAGAGTCAGGTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-1156s1c1
Sequence:CCGGGACAGAATCTTGGAACTGATTCTCGAGAATCAGTTCCAAGATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010137.3-1426s21c1
Sequence:CCGGGTATCATGTGTGTCAACTATGCTCGAGCATAGTTGACACACATGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010137.3-3414s21c1
Sequence:CCGGAGGAAAGCTTTGGCGTCATTCCTCGAGGAATGACGCCAAAGCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010137.3-1864s21c1
Sequence:CCGGGCAGCCCTGAGGACTACTATTCTCGAGAATAGTAGTCCTCAGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010137
EPAS1 MISSION shRNA Lentiviral Transduction Particles
endothelial PAS domain protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-1155s1c1
Sequence:CCGGCGACAGAATCTTGGAACTGATCTCGAGATCAGTTCCAAGATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010137.2-3281s1c1
Sequence:CCGGCCTCCCTTGAATTACTTCTAACTCGAGTTAGAAGTAATTCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-2412s1c1
Sequence:CCGGGCCTCATGTCTCCATGTTCAACTCGAGTTGAACATGGAGACATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-811s1c1
Sequence:CCGGCGTGAGAACCTGACTCTCAAACTCGAGTTTGAGAGTCAGGTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010137.2-1156s1c1
Sequence:CCGGGACAGAATCTTGGAACTGATTCTCGAGAATCAGTTCCAAGATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010137.3-1426s21c1
Sequence:CCGGGTATCATGTGTGTCAACTATGCTCGAGCATAGTTGACACACATGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010137.3-3414s21c1
Sequence:CCGGAGGAAAGCTTTGGCGTCATTCCTCGAGGAATGACGCCAAAGCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010137.3-1864s21c1
Sequence:CCGGGCAGCCCTGAGGACTACTATTCTCGAGAATAGTAGTCCTCAGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001430
VALIDATED
EPAS1 MISSION shRNA Bacterial Glycerol Stock
endothelial PAS domain protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-517s1c1
Sequence:CCGGAGGTGGAGCTAACAGGACATACTCGAGTATGTCCTGTTAGCTCCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-1631s1c1
Sequence:CCGGCGACCTGAAGATTGAAGTGATCTCGAGATCACTTCAATCTTCAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-2419s1c1
Sequence:CCGGGCGCAAATGTACCCAATGATACTCGAGTATCATTGGGTACATTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-566s1c1
Sequence:CCGGCCATGAGGAGATTCGTGAGAACTCGAGTTCTCACGAATCTCCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-1694s1c1
Sequence:CCGGCAGTACCCAGACGGATTTCAACTCGAGTTGAAATCCGTCTGGGTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001430.3-2758s21c1
Sequence:CCGGGCGCAAATGTACCCAATGATACTCGAGTATCATTGGGTACATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001430.3-2033s21c1
Sequence:CCGGCAGTACCCAGACGGATTTCAACTCGAGTTGAAATCCGTCTGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001430.3-905s21c1
Sequence:CCGGCCATGAGGAGATTCGTGAGAACTCGAGTTCTCACGAATCTCCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001430
VALIDATED
EPAS1 MISSION shRNA shRNA Plasmid DNA
endothelial PAS domain protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-517s1c1
Sequence:CCGGAGGTGGAGCTAACAGGACATACTCGAGTATGTCCTGTTAGCTCCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-1631s1c1
Sequence:CCGGCGACCTGAAGATTGAAGTGATCTCGAGATCACTTCAATCTTCAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-2419s1c1
Sequence:CCGGGCGCAAATGTACCCAATGATACTCGAGTATCATTGGGTACATTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-566s1c1
Sequence:CCGGCCATGAGGAGATTCGTGAGAACTCGAGTTCTCACGAATCTCCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-1694s1c1
Sequence:CCGGCAGTACCCAGACGGATTTCAACTCGAGTTGAAATCCGTCTGGGTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001430.3-2758s21c1
Sequence:CCGGGCGCAAATGTACCCAATGATACTCGAGTATCATTGGGTACATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001430.3-2033s21c1
Sequence:CCGGCAGTACCCAGACGGATTTCAACTCGAGTTGAAATCCGTCTGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001430.3-905s21c1
Sequence:CCGGCCATGAGGAGATTCGTGAGAACTCGAGTTCTCACGAATCTCCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001430
VALIDATED
EPAS1 MISSION shRNA Lentiviral Transduction Particles
endothelial PAS domain protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-517s1c1
Sequence:CCGGAGGTGGAGCTAACAGGACATACTCGAGTATGTCCTGTTAGCTCCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-1631s1c1
Sequence:CCGGCGACCTGAAGATTGAAGTGATCTCGAGATCACTTCAATCTTCAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-2419s1c1
Sequence:CCGGGCGCAAATGTACCCAATGATACTCGAGTATCATTGGGTACATTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-566s1c1
Sequence:CCGGCCATGAGGAGATTCGTGAGAACTCGAGTTCTCACGAATCTCCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001430.x-1694s1c1
Sequence:CCGGCAGTACCCAGACGGATTTCAACTCGAGTTGAAATCCGTCTGGGTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001430.3-2758s21c1
Sequence:CCGGGCGCAAATGTACCCAATGATACTCGAGTATCATTGGGTACATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001430.3-2033s21c1
Sequence:CCGGCAGTACCCAGACGGATTTCAACTCGAGTTGAAATCCGTCTGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001430.3-905s21c1
Sequence:CCGGCCATGAGGAGATTCGTGAGAACTCGAGTTCTCACGAATCTCCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks