EMAIL THIS PAGE TO A FRIEND

EPB41

erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)

170 Gene Product Result for
Synonyms: 4.1R EL1 HE
Gene ID:
Human(2035) Summary: The protein encoded by this gene, together with spectrin and actin, constitute the red cell membrane cytoskeletal network. This complex plays a critical role in erythrocyte shape and deformability. Mutations in this gene are associated with type 1 elliptocytosis (EL1). Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Oct 2009]
sheep(101122082) erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
Domestic Rabbit(100350667) erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
domestic guinea pig(100716550) erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
naked mole-rat(101723472) erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
chicken(396493) erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
dog(442955) erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
domestic cat(101089123) erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
Horse(100056416) erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
cow(281753) erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100687 Anti-EPB41 antibody produced in rabbit affinity isolated antibody rat, guinea pig, canine, horse, mouse, human, rabbit
western blot pricing
HPA028414 Anti-EPB41 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410338 Anti-EPB41 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA028076 Anti-EPB41 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA028412 Anti-EPB41 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2105477 Anti-EPB41, (N-terminal) antibody produced in rabbit affinity isolated antibody canine, horse, rabbit, mouse, human, rat, guinea pig
western blot pricing
SAB4504702 Anti-phospho-EPB41 (pTyr660/418) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4301357 Anti-phospho-EPB41 (pTyr660/418) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
WH0002035M1 Monoclonal Anti-EPB41 antibody produced in mouse clone 3D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004437 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132621 MISSION® esiRNA esiRNA human EPB41 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004437 Rosetta Predictions human pricing
NM_203342 Rosetta Predictions human pricing
NM_203343 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017844 predicted 1335
2 SASI_Hs01_00017845 predicted 1302
3 SASI_Hs01_00017846 predicted 1344
4 SASI_Hs01_00017847 predicted 1546
5 SASI_Hs01_00017848 predicted 1202
6 SASI_Hs01_00017849 predicted 1264
7 SASI_Hs01_00017850 predicted 1471
8 SASI_Hs01_00017851 predicted 1150
9 SASI_Hs02_00337609 predicted 1230
10 SASI_Hs01_00017852 predicted 1686
11 SASI_Hs01_00017853 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201747 predicted 1360
2 SASI_Hs01_00201748 predicted 1323
3 SASI_Hs01_00201749 predicted 1359
4 SASI_Hs01_00201750 predicted 1566
5 SASI_Hs01_00201751 predicted 1212
6 SASI_Hs01_00201752 predicted 1281
7 SASI_Hs01_00201753 predicted 1489
8 SASI_Hs01_00201754 predicted 1169
9 SASI_Hs02_00373276 predicted 1243
10 SASI_Hs01_00201755 predicted 1698
11 SASI_Hs01_00201756 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061070 predicted 1383
2 SASI_Hs01_00061071 predicted 1032
3 SASI_Hs01_00061072 predicted 2511
4 SASI_Hs01_00061073 predicted 1089
5 SASI_Hs01_00061074 predicted 1306
6 SASI_Hs01_00061075 predicted 978
7 SASI_Hs02_00373277 predicted 327
8 SASI_Hs01_00061076 predicted 1171
9 SASI_Hs01_00061077 predicted 1063
10 SASI_Hs01_00061078 predicted 1517
11 SASI_Hs01_00061079 predicted 1374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004437
EPB41 MISSION shRNA Bacterial Glycerol Stock
erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004437.2-3167s1c1
Sequence:CCGGGCTGAGAATGTAGTATTGTTTCTCGAGAAACAATACTACATTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-2164s1c1
Sequence:CCGGCGGCCTAGTGAATGGGATAAACTCGAGTTTATCCCATTCACTAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-1422s1c1
Sequence:CCGGCCTTCTGGTTTACAAAGATAACTCGAGTTATCTTTGTAAACCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-944s1c1
Sequence:CCGGCCTCTAAGACATGGCTGGATTCTCGAGAATCCAGCCATGTCTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-1579s1c1
Sequence:CCGGGCAGCTAAGAAATTATGGAAACTCGAGTTTCCATAATTTCTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004437.3-3009s21c1
Sequence:CCGGCGCGTCTCTCCCTAGTCTTATCTCGAGATAAGACTAGGGAGAGACGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004437.3-1402s21c1
Sequence:CCGGGGACTTGGAAGGAGTAGATATCTCGAGATATCTACTCCTTCCAAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004437
EPB41 MISSION shRNA shRNA Plasmid DNA
erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004437.2-3167s1c1
Sequence:CCGGGCTGAGAATGTAGTATTGTTTCTCGAGAAACAATACTACATTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-2164s1c1
Sequence:CCGGCGGCCTAGTGAATGGGATAAACTCGAGTTTATCCCATTCACTAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-1422s1c1
Sequence:CCGGCCTTCTGGTTTACAAAGATAACTCGAGTTATCTTTGTAAACCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-944s1c1
Sequence:CCGGCCTCTAAGACATGGCTGGATTCTCGAGAATCCAGCCATGTCTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-1579s1c1
Sequence:CCGGGCAGCTAAGAAATTATGGAAACTCGAGTTTCCATAATTTCTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004437.3-3009s21c1
Sequence:CCGGCGCGTCTCTCCCTAGTCTTATCTCGAGATAAGACTAGGGAGAGACGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004437.3-1402s21c1
Sequence:CCGGGGACTTGGAAGGAGTAGATATCTCGAGATATCTACTCCTTCCAAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004437
EPB41 MISSION shRNA Lentiviral Transduction Particles
erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004437.2-3167s1c1
Sequence:CCGGGCTGAGAATGTAGTATTGTTTCTCGAGAAACAATACTACATTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-2164s1c1
Sequence:CCGGCGGCCTAGTGAATGGGATAAACTCGAGTTTATCCCATTCACTAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-1422s1c1
Sequence:CCGGCCTTCTGGTTTACAAAGATAACTCGAGTTATCTTTGTAAACCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-944s1c1
Sequence:CCGGCCTCTAAGACATGGCTGGATTCTCGAGAATCCAGCCATGTCTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004437.2-1579s1c1
Sequence:CCGGGCAGCTAAGAAATTATGGAAACTCGAGTTTCCATAATTTCTTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004437.3-3009s21c1
Sequence:CCGGCGCGTCTCTCCCTAGTCTTATCTCGAGATAAGACTAGGGAGAGACGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004437.3-1402s21c1
Sequence:CCGGGGACTTGGAAGGAGTAGATATCTCGAGATATCTACTCCTTCCAAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)