EMAIL THIS PAGE TO A FRIEND

EPB41L1

erythrocyte membrane protein band 4.1-like 1

235 Gene Product Result for
Synonyms: 4.1N MRD11
Gene ID:
Human(2036) Summary: Erythrocyte membrane protein band 4.1 (EPB41) is a multifunctional protein that mediates interactions between the erythrocyte cytoskeleton and the overlying plasma membrane. The protein encoded by this gene is a neuronally-enriched protein that is structurally similar to EPB41. The encoded protein binds and stabilizes D2 and D3 dopamine receptors at the neuronal plasma membrane. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Rat(59317) erythrocyte membrane protein band 4.1-like 1
chicken(419117) erythrocyte membrane protein band 4.1-like 1
dog(485855) erythrocyte membrane protein band 4.1-like 1
cow(515919) erythrocyte membrane protein band 4.1-like 1
Horse(100055108) erythrocyte membrane protein band 4.1-like 1
domestic cat(101098784) erythrocyte membrane protein band 4.1-like 1
naked mole-rat(101719485) erythrocyte membrane protein band 4.1-like 1
domestic guinea pig(100734338) erythrocyte membrane protein band 4.1-like 1
sheep(101120768) erythrocyte membrane protein band 4.1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012156 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063821 MISSION® esiRNA esiRNA human EPB41L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012156 Rosetta Predictions human pricing
NM_177996 Rosetta Predictions human pricing
NM_021681 Rosetta Predictions rat pricing
NM_172090 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071663 predicted 976
2 SASI_Hs01_00071664 predicted 1000
3 SASI_Hs01_00071665 predicted 1073
4 SASI_Hs02_00343740 predicted 972
5 SASI_Hs01_00071666 predicted 1148
6 SASI_Hs01_00071668 predicted 1264
7 SASI_Hs01_00071669 predicted 925
8 SASI_Hs01_00071670 predicted 1246
9 SASI_Hs02_00343741 predicted 2030
10 SASI_Hs02_00343742 predicted 863
11 SASI_Hs01_00071667 predicted 2719
12 SASI_Hs01_00071671 predicted 2746
13 SASI_Hs01_00071672 predicted 2730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236776 predicted 679
2 SASI_Hs01_00236777 predicted 701
3 SASI_Hs01_00236778 predicted 779
4 SASI_Hs02_00369466 predicted 680
5 SASI_Hs01_00236779 predicted 860
6 SASI_Hs01_00236781 predicted 967
7 SASI_Hs01_00236782 predicted 637
8 SASI_Hs01_00236783 predicted 960
9 SASI_Hs02_00369467 predicted 1703
10 SASI_Hs02_00369468 predicted 576
11 SASI_Hs01_00236780 predicted 2309
12 SASI_Hs01_00236784 predicted 2328
13 SASI_Hs01_00236785 predicted 2314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102936 predicted 1299
2 SASI_Rn02_00262705 predicted 1247
3 SASI_Rn01_00102938 predicted 769
4 SASI_Rn01_00102939 predicted 1251
5 SASI_Rn02_00262706 predicted 1313
6 SASI_Rn02_00262707 predicted 662
7 SASI_Rn01_00102940 predicted 1250
8 SASI_Rn01_00102941 predicted 1306
9 SASI_Rn01_00102942 predicted 799
10 SASI_Rn01_00102943 predicted 677
11 SASI_Rn01_00102937 predicted 713
12 SASI_Rn01_00102944 predicted 1339
13 SASI_Rn01_00102945 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086138 predicted 1282
2 SASI_Rn02_00269188 predicted 1231
3 SASI_Rn01_00086140 predicted 751
4 SASI_Rn01_00086141 predicted 1239
5 SASI_Rn02_00269189 predicted 1291
6 SASI_Rn02_00269190 predicted 640
7 SASI_Rn01_00086142 predicted 1240
8 SASI_Rn01_00086143 predicted 1293
9 SASI_Rn01_00086144 predicted 783
10 SASI_Rn01_00086145 predicted 654
11 SASI_Rn01_00086139 predicted 690
12 SASI_Rn01_00086146 predicted 1327
13 SASI_Rn01_00086147 predicted 684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012156
VALIDATED
EPB41L1 MISSION shRNA Bacterial Glycerol Stock
erythrocyte membrane protein band 4.1-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-2642s21c1
Sequence:CCGGTCGAGAAGCGAATCATCATTACTCGAGTAATGATGATTCGCTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-2511s21c1
Sequence:CCGGCCGTTCTCTTTCTCCGATCATCTCGAGATGATCGGAGAAAGAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-3294s21c1
Sequence:CCGGCCCACTTGAATGCAAAGGAAACTCGAGTTTCCTTTGCATTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-432s21c1
Sequence:CCGGCCAGAAGATTGCCAAGAAATACTCGAGTATTTCTTGGCAATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-2742s21c1
Sequence:CCGGGGTAACCAAAGCTGTCGTATACTCGAGTATACGACAGCTTTGGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-3294s1c1
Sequence:CCGGCCCACTTGAATGCAAAGGAAACTCGAGTTTCCTTTGCATTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-2501s1c1
Sequence:CCGGCCACGGAAATCCGTTCTCTTTCTCGAGAAAGAGAACGGATTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012156.2-1597s1c1
Sequence:CCGGCCAACCAAGATCAAGGAGCTACTCGAGTAGCTCCTTGATCTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-432s1c1
Sequence:CCGGCCAGAAGATTGCCAAGAAATACTCGAGTATTTCTTGGCAATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-2511s1c1
Sequence:CCGGCCGTTCTCTTTCTCCGATCATCTCGAGATGATCGGAGAAAGAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012156
VALIDATED
EPB41L1 MISSION shRNA shRNA Plasmid DNA
erythrocyte membrane protein band 4.1-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-2642s21c1
Sequence:CCGGTCGAGAAGCGAATCATCATTACTCGAGTAATGATGATTCGCTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-2511s21c1
Sequence:CCGGCCGTTCTCTTTCTCCGATCATCTCGAGATGATCGGAGAAAGAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-3294s21c1
Sequence:CCGGCCCACTTGAATGCAAAGGAAACTCGAGTTTCCTTTGCATTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-432s21c1
Sequence:CCGGCCAGAAGATTGCCAAGAAATACTCGAGTATTTCTTGGCAATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-2742s21c1
Sequence:CCGGGGTAACCAAAGCTGTCGTATACTCGAGTATACGACAGCTTTGGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-3294s1c1
Sequence:CCGGCCCACTTGAATGCAAAGGAAACTCGAGTTTCCTTTGCATTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-2501s1c1
Sequence:CCGGCCACGGAAATCCGTTCTCTTTCTCGAGAAAGAGAACGGATTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012156.2-1597s1c1
Sequence:CCGGCCAACCAAGATCAAGGAGCTACTCGAGTAGCTCCTTGATCTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-432s1c1
Sequence:CCGGCCAGAAGATTGCCAAGAAATACTCGAGTATTTCTTGGCAATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-2511s1c1
Sequence:CCGGCCGTTCTCTTTCTCCGATCATCTCGAGATGATCGGAGAAAGAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012156
VALIDATED
EPB41L1 MISSION shRNA Lentiviral Transduction Particles
erythrocyte membrane protein band 4.1-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-2642s21c1
Sequence:CCGGTCGAGAAGCGAATCATCATTACTCGAGTAATGATGATTCGCTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-2511s21c1
Sequence:CCGGCCGTTCTCTTTCTCCGATCATCTCGAGATGATCGGAGAAAGAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-3294s21c1
Sequence:CCGGCCCACTTGAATGCAAAGGAAACTCGAGTTTCCTTTGCATTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-432s21c1
Sequence:CCGGCCAGAAGATTGCCAAGAAATACTCGAGTATTTCTTGGCAATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_012156.2-2742s21c1
Sequence:CCGGGGTAACCAAAGCTGTCGTATACTCGAGTATACGACAGCTTTGGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-3294s1c1
Sequence:CCGGCCCACTTGAATGCAAAGGAAACTCGAGTTTCCTTTGCATTCAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-2501s1c1
Sequence:CCGGCCACGGAAATCCGTTCTCTTTCTCGAGAAAGAGAACGGATTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012156.2-1597s1c1
Sequence:CCGGCCAACCAAGATCAAGGAGCTACTCGAGTAGCTCCTTGATCTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-432s1c1
Sequence:CCGGCCAGAAGATTGCCAAGAAATACTCGAGTATTTCTTGGCAATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012156.2-2511s1c1
Sequence:CCGGCCGTTCTCTTTCTCCGATCATCTCGAGATGATCGGAGAAAGAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks