EMAIL THIS PAGE TO A FRIEND

EPB41L2

erythrocyte membrane protein band 4.1-like 2

45 Gene Product Result for
Synonyms: 4.1-G 4.1G
UniProtKB ID: O43491, B4DHI8, E9PPD9, Q5T4F0, Q68DV2
Gene ID:
Rat(309557) erythrocyte membrane protein band 4.1-like 2
sheep(101120756) erythrocyte membrane protein band 4.1-like 2
Domestic Rabbit(100342385) erythrocyte membrane protein band 4.1-like 2
domestic guinea pig(100733594) erythrocyte membrane protein band 4.1-like 2
naked mole-rat(101701106) erythrocyte membrane protein band 4.1-like 2
Zebrafish(100329282) erythrocyte membrane protein band 4.1-like 2
chicken(421703) erythrocyte membrane protein band 4.1-like 2
domestic cat(101088752) erythrocyte membrane protein band 4.1-like 2
cow(538959) erythrocyte membrane protein band 4.1-like 2
dog(484127) erythrocyte membrane protein band 4.1-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001431 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083731 MISSION® esiRNA esiRNA human EPB41L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001431 Rosetta Predictions human pricing
XM_001053351 Rosetta Predictions rat pricing
XM_220117 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331834 predicted 2439
2 SASI_Hs01_00148855 predicted 1466
3 SASI_Hs01_00148856 predicted 709
4 SASI_Hs02_00331835 predicted 2858
5 SASI_Hs01_00148858 predicted 1231
6 SASI_Hs01_00148860 predicted 1648
7 SASI_Hs01_00148861 predicted 2458
8 SASI_Hs01_00148862 predicted 883
9 SASI_Hs01_00148863 predicted 2091
10 SASI_Hs01_00148864 predicted 858
11 SASI_Hs01_00148857 predicted 974
12 SASI_Hs01_00148859 predicted 2814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272047 predicted 2767
2 SASI_Rn02_00272048 predicted 4082
3 SASI_Rn02_00272049 predicted 351
4 SASI_Rn02_00272050 predicted 2169
5 SASI_Rn02_00272051 predicted 3083
6 SASI_Rn02_00272052 predicted 2636
7 SASI_Rn02_00272053 predicted 850
8 SASI_Rn02_00272054 predicted 1351
9 SASI_Rn02_00272055 predicted 1137
10 SASI_Rn02_00272056 predicted 3815
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379065 predicted 2767
2 SASI_Rn02_00379066 predicted 4081
3 SASI_Rn02_00379067 predicted 346
4 SASI_Rn02_00379068 predicted 2167
5 SASI_Rn02_00379069 predicted 3083
6 SASI_Rn02_00379070 predicted 2639
7 SASI_Rn02_00379071 predicted 844
8 SASI_Rn02_00379072 predicted 1343
9 SASI_Rn02_00379073 predicted 1140
10 SASI_Rn02_00379074 predicted 3819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001431
VALIDATED
EPB41L2 MISSION shRNA Bacterial Glycerol Stock
erythrocyte membrane protein band 4.1-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-4033s1c1
Sequence:CCGGCCTATCTCTTTCAGATAGTTTCTCGAGAAACTATCTGAAAGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-2457s1c1
Sequence:CCGGGCCAGTGTAATCACAGTAGAACTCGAGTTCTACTGTGATTACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-1724s1c1
Sequence:CCGGCCAAAGTCTTATGAAGGATTTCTCGAGAAATCCTTCATAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-536s1c1
Sequence:CCGGGCCTACTGAATTAGTAAGTAACTCGAGTTACTTACTAATTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001431.3-2126s21c1
Sequence:CCGGTAGTGAACTCAAGCGCAATTTCTCGAGAAATTGCGCTTGAGTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001431.3-4171s21c1
Sequence:CCGGCCTATCTCTTTCAGATAGTTTCTCGAGAAACTATCTGAAAGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001431.3-674s21c1
Sequence:CCGGGCCTACTGAATTAGTAAGTAACTCGAGTTACTTACTAATTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001431.3-2595s21c1
Sequence:CCGGGCCAGTGTAATCACAGTAGAACTCGAGTTCTACTGTGATTACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001431.3-1862s21c1
Sequence:CCGGCCAAAGTCTTATGAAGGATTTCTCGAGAAATCCTTCATAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001431
VALIDATED
EPB41L2 MISSION shRNA shRNA Plasmid DNA
erythrocyte membrane protein band 4.1-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-4033s1c1
Sequence:CCGGCCTATCTCTTTCAGATAGTTTCTCGAGAAACTATCTGAAAGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-2457s1c1
Sequence:CCGGGCCAGTGTAATCACAGTAGAACTCGAGTTCTACTGTGATTACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-1724s1c1
Sequence:CCGGCCAAAGTCTTATGAAGGATTTCTCGAGAAATCCTTCATAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-536s1c1
Sequence:CCGGGCCTACTGAATTAGTAAGTAACTCGAGTTACTTACTAATTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001431.3-2126s21c1
Sequence:CCGGTAGTGAACTCAAGCGCAATTTCTCGAGAAATTGCGCTTGAGTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001431.3-4171s21c1
Sequence:CCGGCCTATCTCTTTCAGATAGTTTCTCGAGAAACTATCTGAAAGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001431.3-674s21c1
Sequence:CCGGGCCTACTGAATTAGTAAGTAACTCGAGTTACTTACTAATTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001431.3-2595s21c1
Sequence:CCGGGCCAGTGTAATCACAGTAGAACTCGAGTTCTACTGTGATTACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001431.3-1862s21c1
Sequence:CCGGCCAAAGTCTTATGAAGGATTTCTCGAGAAATCCTTCATAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001431
VALIDATED
EPB41L2 MISSION shRNA Lentiviral Transduction Particles
erythrocyte membrane protein band 4.1-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-4033s1c1
Sequence:CCGGCCTATCTCTTTCAGATAGTTTCTCGAGAAACTATCTGAAAGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-2457s1c1
Sequence:CCGGGCCAGTGTAATCACAGTAGAACTCGAGTTCTACTGTGATTACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-1724s1c1
Sequence:CCGGCCAAAGTCTTATGAAGGATTTCTCGAGAAATCCTTCATAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001431.1-536s1c1
Sequence:CCGGGCCTACTGAATTAGTAAGTAACTCGAGTTACTTACTAATTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001431.3-2126s21c1
Sequence:CCGGTAGTGAACTCAAGCGCAATTTCTCGAGAAATTGCGCTTGAGTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001431.3-4171s21c1
Sequence:CCGGCCTATCTCTTTCAGATAGTTTCTCGAGAAACTATCTGAAAGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001431.3-674s21c1
Sequence:CCGGGCCTACTGAATTAGTAAGTAACTCGAGTTACTTACTAATTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001431.3-2595s21c1
Sequence:CCGGGCCAGTGTAATCACAGTAGAACTCGAGTTCTACTGTGATTACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001431.3-1862s21c1
Sequence:CCGGCCAAAGTCTTATGAAGGATTTCTCGAGAAATCCTTCATAAGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks