EMAIL THIS PAGE TO A FRIEND

EPB41L3

erythrocyte membrane protein band 4.1-like 3

45 Gene Product Result for
Synonyms: 4.1B DAL-1 DAL1
UniProtKB ID: Q9Y2J2, O95713, Q9BRP5
Gene ID:
Rat(116724) erythrocyte membrane protein band 4.1-like 3
chicken(421055) erythrocyte membrane protein band 4.1-like 3
dog(480198) erythrocyte membrane protein band 4.1-like 3
cow(532616) erythrocyte membrane protein band 4.1-like 3
Horse(100059101) erythrocyte membrane protein band 4.1-like 3
domestic cat(101083805) erythrocyte membrane protein band 4.1-like 3
naked mole-rat(101703151) erythrocyte membrane protein band 4.1-like 3
domestic guinea pig(100715665) erythrocyte membrane protein band 4.1-like 3
sheep(101106481) erythrocyte membrane protein band 4.1-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012307 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157471 MISSION® esiRNA esiRNA human EPB41L3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012307 Rosetta Predictions human pricing
NM_053927 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055812 predicted 3032
2 SASI_Hs01_00055813 predicted 3335
3 SASI_Hs01_00055814 predicted 822
4 SASI_Hs01_00055815 predicted 690
5 SASI_Hs01_00055816 predicted 809
6 SASI_Hs01_00055817 predicted 1206
7 SASI_Hs02_00344078 predicted 3011
8 SASI_Hs01_00055821 predicted 2959
9 SASI_Hs02_00344079 predicted 530
10 SASI_Hs02_00344080 predicted 2538
11 SASI_Hs01_00055818 predicted 1096
12 SASI_Hs01_00055819 predicted 1227
13 SASI_Hs01_00055820 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266875 predicted 1067
2 SASI_Rn01_00060452 predicted 672
3 SASI_Rn01_00060453 predicted 1503
4 SASI_Rn01_00060454 predicted 500
5 SASI_Rn01_00060455 predicted 330
6 SASI_Rn02_00266876 predicted 797
7 SASI_Rn01_00060456 predicted 3334
8 SASI_Rn01_00060457 predicted 3131
9 SASI_Rn01_00060458 predicted 530
10 SASI_Rn01_00060459 predicted 490
11 SASI_Rn01_00060451 predicted 2718
12 SASI_Rn01_00060460 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012307
EPB41L3 MISSION shRNA Bacterial Glycerol Stock
erythrocyte membrane protein band 4.1-like 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012307.2-324s21c1
Sequence:CCGGCAGCAATTAGAAGACGATAAACTCGAGTTTATCGTCTTCTAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012307.2-3479s21c1
Sequence:CCGGGAATTGACCTTGACCATTAATCTCGAGATTAATGGTCAAGGTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012307.2-3523s1c1
Sequence:CCGGCCCATAATAAAGCAATCTGATCTCGAGATCAGATTGCTTTATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-2884s1c1
Sequence:CCGGCCATCCACATTTCAGAAACTTCTCGAGAAGTTTCTGAAATGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-1062s1c1
Sequence:CCGGCGGCTGCGAATAAACAGATTTCTCGAGAAATCTGTTTATTCGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-1204s1c1
Sequence:CCGGCCAAGCGTTTATGGAAAGTATCTCGAGATACTTTCCATAAACGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-1143s1c1
Sequence:CCGGCCGGGAGAGTTTGAACAATTTCTCGAGAAATTGTTCAAACTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012307
EPB41L3 MISSION shRNA shRNA Plasmid DNA
erythrocyte membrane protein band 4.1-like 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012307.2-324s21c1
Sequence:CCGGCAGCAATTAGAAGACGATAAACTCGAGTTTATCGTCTTCTAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012307.2-3479s21c1
Sequence:CCGGGAATTGACCTTGACCATTAATCTCGAGATTAATGGTCAAGGTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012307.2-3523s1c1
Sequence:CCGGCCCATAATAAAGCAATCTGATCTCGAGATCAGATTGCTTTATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-2884s1c1
Sequence:CCGGCCATCCACATTTCAGAAACTTCTCGAGAAGTTTCTGAAATGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-1062s1c1
Sequence:CCGGCGGCTGCGAATAAACAGATTTCTCGAGAAATCTGTTTATTCGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-1204s1c1
Sequence:CCGGCCAAGCGTTTATGGAAAGTATCTCGAGATACTTTCCATAAACGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-1143s1c1
Sequence:CCGGCCGGGAGAGTTTGAACAATTTCTCGAGAAATTGTTCAAACTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012307
EPB41L3 MISSION shRNA Lentiviral Transduction Particles
erythrocyte membrane protein band 4.1-like 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012307.2-324s21c1
Sequence:CCGGCAGCAATTAGAAGACGATAAACTCGAGTTTATCGTCTTCTAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012307.2-3479s21c1
Sequence:CCGGGAATTGACCTTGACCATTAATCTCGAGATTAATGGTCAAGGTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012307.2-3523s1c1
Sequence:CCGGCCCATAATAAAGCAATCTGATCTCGAGATCAGATTGCTTTATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-2884s1c1
Sequence:CCGGCCATCCACATTTCAGAAACTTCTCGAGAAGTTTCTGAAATGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-1062s1c1
Sequence:CCGGCGGCTGCGAATAAACAGATTTCTCGAGAAATCTGTTTATTCGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-1204s1c1
Sequence:CCGGCCAAGCGTTTATGGAAAGTATCTCGAGATACTTTCCATAAACGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012307.2-1143s1c1
Sequence:CCGGCCGGGAGAGTTTGAACAATTTCTCGAGAAATTGTTCAAACTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks