EMAIL THIS PAGE TO A FRIEND

EPB41L4A-AS1

EPB41L4A antisense RNA 1

22 Gene Product Result for
Synonyms: C5orf26 NCRNA00219 TIGA1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053000 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053000 Rosetta Predictions human pricing
NR_015370 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075304 predicted 653
2 SASI_Hs01_00075305 predicted 568
3 SASI_Hs01_00075306 predicted 351
4 SASI_Hs01_00075307 predicted 483
5 SASI_Hs01_00075308 predicted 285
6 SASI_Hs01_00075309 predicted 403
7 SASI_Hs01_00075310 predicted 648
8 SASI_Hs01_00075311 predicted 483
9 SASI_Hs01_00075312 predicted 458
10 SASI_Hs01_00075313 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381294 predicted 450
2 SASI_Hs02_00381295 predicted 324
3 SASI_Hs02_00381296 predicted 243
4 SASI_Hs02_00381297 predicted 423
5 SASI_Hs02_00381298 predicted 412
6 SASI_Hs02_00381299 predicted 315
7 SASI_Hs02_00381300 predicted 269
8 SASI_Hs02_00381301 predicted 279
9 SASI_Hs02_00381302 predicted 209
10 SASI_Hs02_00381303 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053000
VALIDATED
EPB41L4A-AS1 MISSION shRNA Bacterial Glycerol Stock
EPB41L4A antisense RNA 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000116217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053000.1-649s1c1
Sequence:CCGGCCTTACCGTATAACTGACTTTCTCGAGAAAGTCAGTTATACGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053000.1-578s1c1
Sequence:CCGGTGTGTTTACATCATCGACTATCTCGAGATAGTCGATGATGTAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053000.1-294s1c1
Sequence:CCGGTGGGTCCTTCCACTTGTAGAACTCGAGTTCTACAAGTGGAAGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053000.1-570s1c1
Sequence:CCGGCGTCGATTTGTGTTTACATCACTCGAGTGATGTAAACACAAATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053000
VALIDATED
EPB41L4A-AS1 MISSION shRNA shRNA Plasmid DNA
EPB41L4A antisense RNA 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000116217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053000.1-649s1c1
Sequence:CCGGCCTTACCGTATAACTGACTTTCTCGAGAAAGTCAGTTATACGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053000.1-578s1c1
Sequence:CCGGTGTGTTTACATCATCGACTATCTCGAGATAGTCGATGATGTAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053000.1-294s1c1
Sequence:CCGGTGGGTCCTTCCACTTGTAGAACTCGAGTTCTACAAGTGGAAGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053000.1-570s1c1
Sequence:CCGGCGTCGATTTGTGTTTACATCACTCGAGTGATGTAAACACAAATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053000
VALIDATED
EPB41L4A-AS1 MISSION shRNA Lentiviral Transduction Particles
EPB41L4A antisense RNA 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000116217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053000.1-649s1c1
Sequence:CCGGCCTTACCGTATAACTGACTTTCTCGAGAAAGTCAGTTATACGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053000.1-578s1c1
Sequence:CCGGTGTGTTTACATCATCGACTATCTCGAGATAGTCGATGATGTAAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053000.1-294s1c1
Sequence:CCGGTGGGTCCTTCCACTTGTAGAACTCGAGTTCTACAAGTGGAAGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053000.1-570s1c1
Sequence:CCGGCGTCGATTTGTGTTTACATCACTCGAGTGATGTAAACACAAATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks