EMAIL THIS PAGE TO A FRIEND

EPB41L4A

erythrocyte membrane protein band 4.1 like 4A

66 Gene Product Result for
Synonyms: EPB41L4 NBL4
UniProtKB ID: Q9HCS5, A4FUI6
Gene ID:
Human(64097) Summary: Members of the band 4.1 protein superfamily, including EPB41L4A, are thought to regulate the interaction between the cytoskeleton and plasma membrane (Ishiguro et al., 2000 [PubMed 10874211]
Rat(307514) erythrocyte membrane protein band 4.1 like 4A
Zebrafish(30470) erythrocyte membrane protein band 4.1 like 4A
dog(479140) erythrocyte membrane protein band 4.1 like 4A
Horse(100064464) erythrocyte membrane protein band 4.1 like 4A
cow(519867) erythrocyte membrane protein band 4.1 like 4A
domestic cat(101095883) erythrocyte membrane protein band 4.1 like 4A
chicken(415608) erythrocyte membrane protein band 4.1 like 4A
sheep(101122032) erythrocyte membrane protein band 4.1 like 4A
domestic guinea pig(100719562) erythrocyte membrane protein band 4.1 like 4A
naked mole-rat(101703328) erythrocyte membrane protein band 4.1 like 4A
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022140 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059471 MISSION® esiRNA esiRNA human EPB41L4A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022140 Rosetta Predictions human pricing
NM_001107397 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111468 predicted 1009
2 SASI_Hs02_00355550 predicted 1197
3 SASI_Hs02_00355551 predicted 445
4 SASI_Hs01_00111469 predicted 362
5 SASI_Hs01_00111470 predicted 1297
6 SASI_Hs01_00111471 predicted 870
7 SASI_Hs01_00111472 predicted 1024
8 SASI_Hs01_00111473 predicted 1320
9 SASI_Hs02_00355552 predicted 1259
10 SASI_Hs01_00111475 predicted 401
11 SASI_Hs01_00111474 predicted 1622
12 SASI_Hs01_00111476 predicted 1749
13 SASI_Hs01_00111477 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228415 predicted 1167
2 SASI_Rn02_00228416 predicted 545
3 SASI_Rn02_00228417 predicted 1507
4 SASI_Rn02_00228418 predicted 1546
5 SASI_Rn02_00228419 predicted 492
6 SASI_Rn02_00228420 predicted 1262
7 SASI_Rn02_00228421 predicted 298
8 SASI_Rn02_00228422 predicted 280
9 SASI_Rn02_00228423 predicted 552
10 SASI_Rn02_00228424 predicted 1504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022140
EPB41L4A MISSION shRNA Bacterial Glycerol Stock
erythrocyte membrane protein band 4.1 like 4A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022140.2-2055s1c1
Sequence:CCGGCCACGAAGTTACCGCCAGTATCTCGAGATACTGGCGGTAACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-1608s1c1
Sequence:CCGGCCTGTGGAAGTGACAATGATTCTCGAGAATCATTGTCACTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-1722s1c1
Sequence:CCGGGCAGTGGTAGTGAATCAGAAACTCGAGTTTCTGATTCACTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-800s1c1
Sequence:CCGGGCCATAGAAAGGATTCATAAACTCGAGTTTATGAATCCTTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-1922s1c1
Sequence:CCGGGAAGAGTTATGGAAGCACATTCTCGAGAATGTGCTTCCATAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022140.3-391s21c1
Sequence:CCGGCGTTGTCCTTGACCACGTATTCTCGAGAATACGTGGTCAAGGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022140.3-1206s21c1
Sequence:CCGGAGTTTGGATCCATACGTTATACTCGAGTATAACGTATGGATCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022140.3-715s21c1
Sequence:CCGGTGGAGATTATGACCCATATAACTCGAGTTATATGGGTCATAATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022140
EPB41L4A MISSION shRNA shRNA Plasmid DNA
erythrocyte membrane protein band 4.1 like 4A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022140.2-2055s1c1
Sequence:CCGGCCACGAAGTTACCGCCAGTATCTCGAGATACTGGCGGTAACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-1608s1c1
Sequence:CCGGCCTGTGGAAGTGACAATGATTCTCGAGAATCATTGTCACTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-1722s1c1
Sequence:CCGGGCAGTGGTAGTGAATCAGAAACTCGAGTTTCTGATTCACTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-800s1c1
Sequence:CCGGGCCATAGAAAGGATTCATAAACTCGAGTTTATGAATCCTTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-1922s1c1
Sequence:CCGGGAAGAGTTATGGAAGCACATTCTCGAGAATGTGCTTCCATAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022140.3-391s21c1
Sequence:CCGGCGTTGTCCTTGACCACGTATTCTCGAGAATACGTGGTCAAGGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022140.3-1206s21c1
Sequence:CCGGAGTTTGGATCCATACGTTATACTCGAGTATAACGTATGGATCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022140.3-715s21c1
Sequence:CCGGTGGAGATTATGACCCATATAACTCGAGTTATATGGGTCATAATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022140
EPB41L4A MISSION shRNA Lentiviral Transduction Particles
erythrocyte membrane protein band 4.1 like 4A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022140.2-2055s1c1
Sequence:CCGGCCACGAAGTTACCGCCAGTATCTCGAGATACTGGCGGTAACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-1608s1c1
Sequence:CCGGCCTGTGGAAGTGACAATGATTCTCGAGAATCATTGTCACTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-1722s1c1
Sequence:CCGGGCAGTGGTAGTGAATCAGAAACTCGAGTTTCTGATTCACTACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-800s1c1
Sequence:CCGGGCCATAGAAAGGATTCATAAACTCGAGTTTATGAATCCTTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022140.2-1922s1c1
Sequence:CCGGGAAGAGTTATGGAAGCACATTCTCGAGAATGTGCTTCCATAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022140.3-391s21c1
Sequence:CCGGCGTTGTCCTTGACCACGTATTCTCGAGAATACGTGGTCAAGGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022140.3-1206s21c1
Sequence:CCGGAGTTTGGATCCATACGTTATACTCGAGTATAACGTATGGATCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022140.3-715s21c1
Sequence:CCGGTGGAGATTATGACCCATATAACTCGAGTTATATGGGTCATAATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks