EMAIL THIS PAGE TO A FRIEND

EPB41L4B

erythrocyte membrane protein band 4.1 like 4B

265 Gene Product Result for
Synonyms: CG1 EHM2
UniProtKB ID: Q9H329, Q5T4G5, Q5T4G6, Q9H328, Q9P2V3
Gene ID:
Rat(500464) erythrocyte membrane protein band 4.1 like 4B
chicken(420962) erythrocyte membrane protein band 4.1 like 4B
cow(519310) erythrocyte membrane protein band 4.1 like 4B
Horse(100059009) erythrocyte membrane protein band 4.1 like 4B
domestic cat(101089905) erythrocyte membrane protein band 4.1 like 4B
dog(474797) erythrocyte membrane protein band 4.1 like 4B
naked mole-rat(101720989) erythrocyte membrane protein band 4.1 like 4B
domestic guinea pig(100713617) erythrocyte membrane protein band 4.1 like 4B
sheep(101122929) erythrocyte membrane protein band 4.1 like 4B
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019114 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135591 MISSION® esiRNA esiRNA human EPB41L4B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018424 Rosetta Predictions human pricing
NM_019114 Rosetta Predictions human pricing
NM_001127565 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051648 predicted 798
2 SASI_Hs01_00051649 predicted 973
3 SASI_Hs01_00051650 predicted 1364
4 SASI_Hs01_00051651 predicted 816
5 SASI_Hs01_00051652 predicted 882
6 SASI_Hs01_00051653 predicted 1413
7 SASI_Hs01_00051654 predicted 1421
8 SASI_Hs01_00051655 predicted 763
9 SASI_Hs01_00051656 predicted 1004
10 SASI_Hs01_00051657 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231021 predicted 803
2 SASI_Hs01_00231022 predicted 974
3 SASI_Hs01_00231023 predicted 1367
4 SASI_Hs01_00231024 predicted 811
5 SASI_Hs01_00231025 predicted 875
6 SASI_Hs01_00231026 predicted 1410
7 SASI_Hs01_00231027 predicted 1425
8 SASI_Hs01_00231028 predicted 766
9 SASI_Hs01_00231029 predicted 1003
10 SASI_Hs01_00231030 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254403 predicted 1487
2 SASI_Rn02_00254404 predicted 561
3 SASI_Rn02_00254405 predicted 609
4 SASI_Rn02_00254406 predicted 968
5 SASI_Rn02_00254407 predicted 327
6 SASI_Rn02_00254408 predicted 685
7 SASI_Rn02_00254409 predicted 1411
8 SASI_Rn02_00254410 predicted 497
9 SASI_Rn02_00254411 predicted 436
10 SASI_Rn02_00254412 predicted 1141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019114
VALIDATED
EPB41L4B MISSION shRNA Bacterial Glycerol Stock
erythrocyte membrane protein band 4.1 like 4B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-2225s1c1
Sequence:CCGGCGCTAGTGTAAGAAGTCCTATCTCGAGATAGGACTTCTTACACTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-2551s1c1
Sequence:CCGGCGGGTGATCTTCTGATGGATTCTCGAGAATCCATCAGAAGATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_019114.2-1547s1c1
Sequence:CCGGCCGGAGACATTCAACGTTCAACTCGAGTTGAACGTTGAATGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-750s1c1
Sequence:CCGGCCTGCTTATGCTTTACACTTTCTCGAGAAAGTGTAAAGCATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-1965s1c1
Sequence:CCGGGCCCATCTAAAGAAGCTGGAACTCGAGTTCCAGCTTCTTTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019114.3-2720s21c1
Sequence:CCGGACATTCCCGGTTGATACAATGCTCGAGCATTGTATCAACCGGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019114.3-715s21c1
Sequence:CCGGGGATCATGCCAAACCCATAAACTCGAGTTTATGGGTTTGGCATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019114.3-2785s21c1
Sequence:CCGGAGACTTCAGAGACAGTAAATTCTCGAGAATTTACTGTCTCTGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019114
VALIDATED
EPB41L4B MISSION shRNA shRNA Plasmid DNA
erythrocyte membrane protein band 4.1 like 4B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-2225s1c1
Sequence:CCGGCGCTAGTGTAAGAAGTCCTATCTCGAGATAGGACTTCTTACACTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-2551s1c1
Sequence:CCGGCGGGTGATCTTCTGATGGATTCTCGAGAATCCATCAGAAGATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_019114.2-1547s1c1
Sequence:CCGGCCGGAGACATTCAACGTTCAACTCGAGTTGAACGTTGAATGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-750s1c1
Sequence:CCGGCCTGCTTATGCTTTACACTTTCTCGAGAAAGTGTAAAGCATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-1965s1c1
Sequence:CCGGGCCCATCTAAAGAAGCTGGAACTCGAGTTCCAGCTTCTTTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019114.3-2720s21c1
Sequence:CCGGACATTCCCGGTTGATACAATGCTCGAGCATTGTATCAACCGGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019114.3-715s21c1
Sequence:CCGGGGATCATGCCAAACCCATAAACTCGAGTTTATGGGTTTGGCATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019114.3-2785s21c1
Sequence:CCGGAGACTTCAGAGACAGTAAATTCTCGAGAATTTACTGTCTCTGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019114
VALIDATED
EPB41L4B MISSION shRNA Lentiviral Transduction Particles
erythrocyte membrane protein band 4.1 like 4B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-2225s1c1
Sequence:CCGGCGCTAGTGTAAGAAGTCCTATCTCGAGATAGGACTTCTTACACTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-2551s1c1
Sequence:CCGGCGGGTGATCTTCTGATGGATTCTCGAGAATCCATCAGAAGATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_019114.2-1547s1c1
Sequence:CCGGCCGGAGACATTCAACGTTCAACTCGAGTTGAACGTTGAATGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-750s1c1
Sequence:CCGGCCTGCTTATGCTTTACACTTTCTCGAGAAAGTGTAAAGCATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019114.2-1965s1c1
Sequence:CCGGGCCCATCTAAAGAAGCTGGAACTCGAGTTCCAGCTTCTTTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019114.3-2720s21c1
Sequence:CCGGACATTCCCGGTTGATACAATGCTCGAGCATTGTATCAACCGGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019114.3-715s21c1
Sequence:CCGGGGATCATGCCAAACCCATAAACTCGAGTTTATGGGTTTGGCATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019114.3-2785s21c1
Sequence:CCGGAGACTTCAGAGACAGTAAATTCTCGAGAATTTACTGTCTCTGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks