EMAIL THIS PAGE TO A FRIEND

EPB42

erythrocyte membrane protein band 4.2

45 Gene Product Result for
Synonyms: PA SPH5
UniProtKB ID: P16452, Q4VB97
Gene ID:
Human(2038) Summary: Erythrocyte membrane protein band 4.2 is an ATP-binding protein which may regulate the association of protein 3 with ankyrin. It probably has a role in erythrocyte shape and mechanical property regulation. Mutations in the EPB42 gene are associated with recessive spherocytic elliptocytosis and recessively transmitted hereditary hemolytic anemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(362202) erythrocyte membrane protein band 4.2
chicken(419216) erythrocyte membrane protein band 4.2
cow(281754) erythrocyte membrane protein band 4.2
Horse(100070868) erythrocyte membrane protein band 4.2
domestic cat(101081052) erythrocyte membrane protein band 4.2
dog(608932) erythrocyte membrane protein band 4.2
naked mole-rat(101714453) erythrocyte membrane protein band 4.2
sheep(101120335) erythrocyte membrane protein band 4.2
Domestic Rabbit(100337829) erythrocyte membrane protein band 4.2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000119 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029671 MISSION® esiRNA esiRNA human EPB42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000119 Rosetta Predictions human pricing
NM_001114134 Rosetta Predictions human pricing
NM_001108590 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030110 predicted 1810
2 SASI_Hs01_00030111 predicted 1412
3 SASI_Hs01_00030114 predicted 1756
4 SASI_Hs01_00030115 predicted 1292
5 SASI_Hs01_00030116 predicted 2176
6 SASI_Hs01_00030117 predicted 1595
7 SASI_Hs01_00030118 predicted 1633
8 SASI_Hs02_00301905 predicted 879
9 SASI_Hs02_00301906 predicted 2275
10 SASI_Hs02_00301907 predicted 805
11 SASI_Hs01_00030109 predicted 2320
12 SASI_Hs01_00030112 predicted 561
13 SASI_Hs01_00030113 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326344 predicted 1719
2 SASI_Hs02_00326345 predicted 1322
3 SASI_Hs02_00326346 predicted 1663
4 SASI_Hs02_00326347 predicted 1205
5 SASI_Hs02_00326348 predicted 2082
6 SASI_Hs02_00326349 predicted 1507
7 SASI_Hs02_00326350 predicted 1541
8 SASI_Hs02_00326351 predicted 794
9 SASI_Hs02_00326352 predicted 2185
10 SASI_Hs02_00326353 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240139 predicted 973
2 SASI_Rn02_00240140 predicted 1110
3 SASI_Rn02_00240141 predicted 507
4 SASI_Rn02_00240142 predicted 1140
5 SASI_Rn02_00240143 predicted 283
6 SASI_Rn02_00240144 predicted 1873
7 SASI_Rn02_00240145 predicted 580
8 SASI_Rn02_00240146 predicted 1106
9 SASI_Rn02_00240147 predicted 1091
10 SASI_Rn02_00240148 predicted 1078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000119
EPB42 MISSION shRNA Bacterial Glycerol Stock
erythrocyte membrane protein band 4.2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-773s1c1
Sequence:CCGGCCCAAGCCACATTCCCAATTTCTCGAGAAATTGGGAATGTGGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-2284s1c1
Sequence:CCGGGCTCAGGAAGACATTGCCATTCTCGAGAATGGCAATGTCTTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-1449s1c1
Sequence:CCGGGCGTCTTCTCATAGATGAATACTCGAGTATTCATCTATGAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-1833s1c1
Sequence:CCGGCGAGGACATCACTCAGAACTACTCGAGTAGTTCTGAGTGATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-1969s1c1
Sequence:CCGGCCTCTGTACCTGCTCTTGAAACTCGAGTTTCAAGAGCAGGTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000119.2-1867s21c1
Sequence:CCGGATCTCAGTGACGCTGGTTAATCTCGAGATTAACCAGCGTCACTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000119.2-1435s21c1
Sequence:CCGGCTGCACCCAAGTGCTCCTAATCTCGAGATTAGGAGCACTTGGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000119.2-2097s21c1
Sequence:CCGGACACTCTGAATCCAACCTTAGCTCGAGCTAAGGTTGGATTCAGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000119
EPB42 MISSION shRNA shRNA Plasmid DNA
erythrocyte membrane protein band 4.2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-773s1c1
Sequence:CCGGCCCAAGCCACATTCCCAATTTCTCGAGAAATTGGGAATGTGGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-2284s1c1
Sequence:CCGGGCTCAGGAAGACATTGCCATTCTCGAGAATGGCAATGTCTTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-1449s1c1
Sequence:CCGGGCGTCTTCTCATAGATGAATACTCGAGTATTCATCTATGAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-1833s1c1
Sequence:CCGGCGAGGACATCACTCAGAACTACTCGAGTAGTTCTGAGTGATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-1969s1c1
Sequence:CCGGCCTCTGTACCTGCTCTTGAAACTCGAGTTTCAAGAGCAGGTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000119.2-1867s21c1
Sequence:CCGGATCTCAGTGACGCTGGTTAATCTCGAGATTAACCAGCGTCACTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000119.2-1435s21c1
Sequence:CCGGCTGCACCCAAGTGCTCCTAATCTCGAGATTAGGAGCACTTGGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000119.2-2097s21c1
Sequence:CCGGACACTCTGAATCCAACCTTAGCTCGAGCTAAGGTTGGATTCAGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000119
EPB42 MISSION shRNA Lentiviral Transduction Particles
erythrocyte membrane protein band 4.2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-773s1c1
Sequence:CCGGCCCAAGCCACATTCCCAATTTCTCGAGAAATTGGGAATGTGGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-2284s1c1
Sequence:CCGGGCTCAGGAAGACATTGCCATTCTCGAGAATGGCAATGTCTTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-1449s1c1
Sequence:CCGGGCGTCTTCTCATAGATGAATACTCGAGTATTCATCTATGAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-1833s1c1
Sequence:CCGGCGAGGACATCACTCAGAACTACTCGAGTAGTTCTGAGTGATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000119.1-1969s1c1
Sequence:CCGGCCTCTGTACCTGCTCTTGAAACTCGAGTTTCAAGAGCAGGTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000119.2-1867s21c1
Sequence:CCGGATCTCAGTGACGCTGGTTAATCTCGAGATTAACCAGCGTCACTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000119.2-1435s21c1
Sequence:CCGGCTGCACCCAAGTGCTCCTAATCTCGAGATTAGGAGCACTTGGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000119.2-2097s21c1
Sequence:CCGGACACTCTGAATCCAACCTTAGCTCGAGCTAAGGTTGGATTCAGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks