EMAIL THIS PAGE TO A FRIEND

EPC1

enhancer of polycomb homolog 1 (Drosophila)

65 Gene Product Result for
Synonyms: Epl1
Gene ID:
Human(80314) Summary: This gene encodes a member of the polycomb group (PcG) family. The encoded protein is a component of the NuA4 histone acetyltransferase complex and can act as both a transcriptional activator and repressor. The encoded protein has been linked to apoptosis, DNA repair, skeletal muscle differentiation, gene silencing, and adult T-cell leukemia/lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(13831) enhancer of polycomb homolog 1 (Drosophila)
Rat(100362678) enhancer of polycomb homolog 1 (Drosophila)
Zebrafish(566686) enhancer of polycomb homolog 1 (Drosophila)
Horse(100060812) enhancer of polycomb homolog 1 (Drosophila)
cow(534386) enhancer of polycomb homolog 1 (Drosophila)
domestic cat(101093194) enhancer of polycomb homolog 1 (Drosophila)
dog(477970) enhancer of polycomb homolog 1 (Drosophila)
Thale Cress(824749) glycosyltransferase family 64 protein EPC1
chicken(420471) enhancer of polycomb homolog 1 (Drosophila)
sheep(101113778) enhancer of polycomb homolog 1 (Drosophila)
Domestic Rabbit(100353948) enhancer of polycomb homolog 1 (Drosophila)
domestic guinea pig(100726382) enhancer of polycomb homolog 1 (Drosophila)
naked mole-rat(101718758) enhancer of polycomb homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306753 ANTI-EPC1 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
SAB2108122 Anti-EPC1 antibody produced in rabbit pig, horse, guinea pig, rabbit, canine, mouse, bovine, rat, human
western blot pricing
SAB2100688 Anti-EPC1 antibody produced in rabbit affinity isolated antibody, lyophilized powder pig, horse, rabbit, mouse, canine, human, chicken, bovine, rat
western blot pricing
SAB1403378 Monoclonal Anti-EPC1 antibody produced in mouse clone 4F7, ascites fluid human
ELISA pricing
PLA0275 Rabbit anti-EPC1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. horse, bovine, dog, chimpanzee, mouse, human, rat, rhesus monkey, rabbit, primate, gorilla
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025209 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025209 Rosetta Predictions human pricing
NM_007935 Rosetta Predictions mouse pricing
NM_027497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236746 predicted 1174
2 SASI_Hs02_00357986 predicted 1814
3 SASI_Hs01_00236747 predicted 1572
4 SASI_Hs01_00236749 predicted 2589
5 SASI_Hs01_00236750 predicted 345
6 SASI_Hs01_00236751 predicted 1360
7 SASI_Hs01_00236752 predicted 2448
8 SASI_Hs01_00236754 predicted 1682
9 SASI_Hs01_00236755 predicted 1253
10 SASI_Hs02_00357987 predicted 2521
11 SASI_Hs01_00236748 predicted 2279
12 SASI_Hs01_00236753 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199391 predicted 2149
2 SASI_Mm01_00199392 predicted 2317
3 SASI_Mm01_00199394 predicted 741
4 SASI_Mm01_00199395 predicted 1473
5 SASI_Mm01_00199396 predicted 1244
6 SASI_Mm01_00199397 predicted 2174
7 SASI_Mm01_00199398 predicted 1594
8 SASI_Mm01_00199399 predicted 1366
9 SASI_Mm02_00312773 predicted 473
10 SASI_Mm02_00312774 predicted 585
11 SASI_Mm01_00199393 predicted 1054
12 SASI_Mm01_00199400 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197634 predicted 2326
2 SASI_Mm01_00197635 predicted 2493
3 SASI_Mm01_00197637 predicted 910
4 SASI_Mm01_00197638 predicted 1647
5 SASI_Mm01_00197639 predicted 1418
6 SASI_Mm01_00197640 predicted 2349
7 SASI_Mm01_00197641 predicted 1760
8 SASI_Mm01_00197642 predicted 1543
9 SASI_Mm02_00332324 predicted 645
10 SASI_Mm02_00332325 predicted 748
11 SASI_Mm01_00197636 predicted 1230
12 SASI_Mm01_00197643 predicted 1222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027497
VALIDATED
EPC1 MISSION shRNA Bacterial Glycerol Stock
enhancer of polycomb homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-444s21c1
Sequence:CCGGAGCGGGATAACATGGTTATTCCTCGAGGAATAACCATGTTATCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-2309s21c1
Sequence:CCGGTCGACAGCAGGTTCAACTTTGCTCGAGCAAAGTTGAACCTGCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-326s21c1
Sequence:CCGGCACGAATACGCCTCGATAAACCTCGAGGTTTATCGAGGCGTATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-2370s21c1
Sequence:CCGGGCTCACTGAGTCACCAAGTAACTCGAGTTACTTGGTGACTCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027497.2-2825s21c1
Sequence:CCGGCTCGTGCTTCAACCTTTCTTTCTCGAGAAAGAAAGGTTGAAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027497.1-2826s1c1
Sequence:CCGGCTCGTGCTTCAACCTTTCTTTCTCGAGAAAGAAAGGTTGAAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027497.1-1716s1c1
Sequence:CCGGCCAGTCAATCAGTTTGCCAATCTCGAGATTGGCAAACTGATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027497.1-491s1c1
Sequence:CCGGCGCTTACTATGAGTCCATATACTCGAGTATATGGACTCATAGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027497.1-2371s1c1
Sequence:CCGGGCTCACTGAGTCACCAAGTAACTCGAGTTACTTGGTGACTCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027497
VALIDATED
EPC1 MISSION shRNA shRNA Plasmid DNA
enhancer of polycomb homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-444s21c1
Sequence:CCGGAGCGGGATAACATGGTTATTCCTCGAGGAATAACCATGTTATCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-2309s21c1
Sequence:CCGGTCGACAGCAGGTTCAACTTTGCTCGAGCAAAGTTGAACCTGCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-326s21c1
Sequence:CCGGCACGAATACGCCTCGATAAACCTCGAGGTTTATCGAGGCGTATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-2370s21c1
Sequence:CCGGGCTCACTGAGTCACCAAGTAACTCGAGTTACTTGGTGACTCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027497.2-2825s21c1
Sequence:CCGGCTCGTGCTTCAACCTTTCTTTCTCGAGAAAGAAAGGTTGAAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027497.1-2826s1c1
Sequence:CCGGCTCGTGCTTCAACCTTTCTTTCTCGAGAAAGAAAGGTTGAAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027497.1-1716s1c1
Sequence:CCGGCCAGTCAATCAGTTTGCCAATCTCGAGATTGGCAAACTGATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027497.1-491s1c1
Sequence:CCGGCGCTTACTATGAGTCCATATACTCGAGTATATGGACTCATAGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027497.1-2371s1c1
Sequence:CCGGGCTCACTGAGTCACCAAGTAACTCGAGTTACTTGGTGACTCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027497
VALIDATED
EPC1 MISSION shRNA Lentiviral Transduction Particles
enhancer of polycomb homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-444s21c1
Sequence:CCGGAGCGGGATAACATGGTTATTCCTCGAGGAATAACCATGTTATCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-2309s21c1
Sequence:CCGGTCGACAGCAGGTTCAACTTTGCTCGAGCAAAGTTGAACCTGCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-326s21c1
Sequence:CCGGCACGAATACGCCTCGATAAACCTCGAGGTTTATCGAGGCGTATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027497.2-2370s21c1
Sequence:CCGGGCTCACTGAGTCACCAAGTAACTCGAGTTACTTGGTGACTCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027497.2-2825s21c1
Sequence:CCGGCTCGTGCTTCAACCTTTCTTTCTCGAGAAAGAAAGGTTGAAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027497.1-2826s1c1
Sequence:CCGGCTCGTGCTTCAACCTTTCTTTCTCGAGAAAGAAAGGTTGAAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027497.1-1716s1c1
Sequence:CCGGCCAGTCAATCAGTTTGCCAATCTCGAGATTGGCAAACTGATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027497.1-491s1c1
Sequence:CCGGCGCTTACTATGAGTCCATATACTCGAGTATATGGACTCATAGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027497.1-2371s1c1
Sequence:CCGGGCTCACTGAGTCACCAAGTAACTCGAGTTACTTGGTGACTCAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025209
EPC1 MISSION shRNA Bacterial Glycerol Stock
enhancer of polycomb homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-355s21c1
Sequence:CCGGCACGAATACGCCTCGATAAACCTCGAGGTTTATCGAGGCGTATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-519s21c1
Sequence:CCGGTGCTTACTATGAGTCTATATACTCGAGTATATAGACTCATAGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-1245s1c2
Sequence:CCGGGCAAGATAAAGCCGATCTTATCTCGAGATAAGATCGGCTTTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-1141s21c1
Sequence:GTACCGGCAGCCAATGAAACCTACTTATCTCGAGATAAGTAGGTTTCATTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-1264s21c1
Sequence:CCGGATCCGACCGAAACGGAAATATCTCGAGATATTTCCGTTTCGGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-465s21c1
Sequence:CCGGTGGCGAGAAGAGGGATAATATCTCGAGATATTATCCCTCTTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-2023s1c1
Sequence:CCGGGCCGAACAATACCAGCAACATCTCGAGATGTTGCTGGTATTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-2422s1c1
Sequence:CCGGGCTTTGTTACAGCCTTCAAATCTCGAGATTTGAAGGCTGTAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-567s1c1
Sequence:CCGGGCTCATTCACATACAGCCTTTCTCGAGAAAGGCTGTATGTGAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-1354s1c1
Sequence:CCGGCCAGTCTTCAATGCTAAAGATCTCGAGATCTTTAGCATTGAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025209
EPC1 MISSION shRNA shRNA Plasmid DNA
enhancer of polycomb homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-355s21c1
Sequence:CCGGCACGAATACGCCTCGATAAACCTCGAGGTTTATCGAGGCGTATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-519s21c1
Sequence:CCGGTGCTTACTATGAGTCTATATACTCGAGTATATAGACTCATAGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-1245s1c2
Sequence:CCGGGCAAGATAAAGCCGATCTTATCTCGAGATAAGATCGGCTTTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-1141s21c1
Sequence:GTACCGGCAGCCAATGAAACCTACTTATCTCGAGATAAGTAGGTTTCATTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-1264s21c1
Sequence:CCGGATCCGACCGAAACGGAAATATCTCGAGATATTTCCGTTTCGGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-465s21c1
Sequence:CCGGTGGCGAGAAGAGGGATAATATCTCGAGATATTATCCCTCTTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-2023s1c1
Sequence:CCGGGCCGAACAATACCAGCAACATCTCGAGATGTTGCTGGTATTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-2422s1c1
Sequence:CCGGGCTTTGTTACAGCCTTCAAATCTCGAGATTTGAAGGCTGTAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-567s1c1
Sequence:CCGGGCTCATTCACATACAGCCTTTCTCGAGAAAGGCTGTATGTGAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-1354s1c1
Sequence:CCGGCCAGTCTTCAATGCTAAAGATCTCGAGATCTTTAGCATTGAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025209
EPC1 MISSION shRNA Lentiviral Transduction Particles
enhancer of polycomb homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-355s21c1
Sequence:CCGGCACGAATACGCCTCGATAAACCTCGAGGTTTATCGAGGCGTATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-519s21c1
Sequence:CCGGTGCTTACTATGAGTCTATATACTCGAGTATATAGACTCATAGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-1245s1c2
Sequence:CCGGGCAAGATAAAGCCGATCTTATCTCGAGATAAGATCGGCTTTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-1141s21c1
Sequence:GTACCGGCAGCCAATGAAACCTACTTATCTCGAGATAAGTAGGTTTCATTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-1264s21c1
Sequence:CCGGATCCGACCGAAACGGAAATATCTCGAGATATTTCCGTTTCGGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025209.2-465s21c1
Sequence:CCGGTGGCGAGAAGAGGGATAATATCTCGAGATATTATCCCTCTTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-2023s1c1
Sequence:CCGGGCCGAACAATACCAGCAACATCTCGAGATGTTGCTGGTATTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-2422s1c1
Sequence:CCGGGCTTTGTTACAGCCTTCAAATCTCGAGATTTGAAGGCTGTAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-567s1c1
Sequence:CCGGGCTCATTCACATACAGCCTTTCTCGAGAAAGGCTGTATGTGAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025209.2-1354s1c1
Sequence:CCGGCCAGTCTTCAATGCTAAAGATCTCGAGATCTTTAGCATTGAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks