EMAIL THIS PAGE TO A FRIEND

EPC2

enhancer of polycomb homolog 2 (Drosophila)

146 Gene Product Result for
Synonyms: EPC-LIKE
Gene ID:
Mouse(227867) enhancer of polycomb homolog 2 (Drosophila)
Rat(362132) enhancer of polycomb homolog 2 (Drosophila)
naked mole-rat(101710813) enhancer of polycomb homolog 2 (Drosophila)
domestic guinea pig(100726988) enhancer of polycomb homolog 2 (Drosophila)
sheep(101121402) enhancer of polycomb homolog 2 (Drosophila)
Zebrafish(394050) enhancer of polycomb homolog 2 (Drosophila)
cow(539432) enhancer of polycomb homolog 2 (Drosophila)
Horse(100049958) enhancer of polycomb homolog 2 (Drosophila)
domestic cat(101098648) enhancer of polycomb homolog 2 (Drosophila)
chicken(424309) enhancer of polycomb homolog 2 (Drosophila)
dog(476143) enhancer of polycomb homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015630 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131321 MISSION® esiRNA esiRNA human EPC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015630 Rosetta Predictions human pricing
NM_001108581 Rosetta Predictions rat pricing
NM_172663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348222 predicted 939
2 SASI_Hs01_00189088 predicted 2396
3 SASI_Hs01_00189089 predicted 2536
4 SASI_Hs01_00189090 predicted 1612
5 SASI_Hs01_00189091 predicted 1229
6 SASI_Hs01_00189093 predicted 1241
7 SASI_Hs01_00189094 predicted 1340
8 SASI_Hs01_00189096 predicted 673
9 SASI_Hs01_00189097 predicted 1135
10 SASI_Hs02_00348223 predicted 954
11 SASI_Hs01_00189092 predicted 2109
12 SASI_Hs01_00189095 predicted 2143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240049 predicted 1778
2 SASI_Rn02_00240050 predicted 1367
3 SASI_Rn02_00240051 predicted 2602
4 SASI_Rn02_00240052 predicted 522
5 SASI_Rn02_00240053 predicted 2441
6 SASI_Rn02_00240054 predicted 2172
7 SASI_Rn02_00240055 predicted 2256
8 SASI_Rn02_00240056 predicted 2453
9 SASI_Rn02_00240057 predicted 1318
10 SASI_Rn02_00240058 predicted 2173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118875 predicted 985
2 SASI_Mm01_00118877 predicted 763
3 SASI_Mm01_00118878 predicted 2483
4 SASI_Mm01_00118880 predicted 1380
5 SASI_Mm01_00118881 predicted 2407
6 SASI_Mm01_00118882 predicted 1163
7 SASI_Mm01_00118883 predicted 2426
8 SASI_Mm01_00118884 predicted 2506
9 SASI_Mm02_00344371 predicted 2697
10 SASI_Mm02_00344372 predicted 1657
11 SASI_Mm01_00118876 predicted 1015
12 SASI_Mm01_00118879 predicted 1642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015630
VALIDATED
EPC2 MISSION shRNA Bacterial Glycerol Stock
enhancer of polycomb homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015630.2-1236s1c1
Sequence:CCGGGCCAGTATTATGCTCCTCGTTCTCGAGAACGAGGAGCATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015630.2-734s1c1
Sequence:CCGGCGAGAATTTAGTAGAGCCATACTCGAGTATGGCTCTACTAAATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015630.2-254s1c1
Sequence:CCGGGCAGAGAGCAACGTCAACTATCTCGAGATAGTTGACGTTGCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015630.2-2122s1c1
Sequence:CCGGCCACACCACTACAAACCACTTCTCGAGAAGTGGTTTGTAGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-1092s21c1
Sequence:CCGGGACATTGCCTGTGATCAATAACTCGAGTTATTGATCACAGGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-522s21c1
Sequence:CCGGCGAAGATGATTACCTTATTAACTCGAGTTAATAAGGTAATCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-353s21c1
Sequence:CCGGACAACGAGCAACCAGATTATGCTCGAGCATAATCTGGTTGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-1404s21c1
Sequence:CCGGGGTCATAATGGACCGAATATCCTCGAGGATATTCGGTCCATTATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015630
VALIDATED
EPC2 MISSION shRNA shRNA Plasmid DNA
enhancer of polycomb homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015630.2-1236s1c1
Sequence:CCGGGCCAGTATTATGCTCCTCGTTCTCGAGAACGAGGAGCATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015630.2-734s1c1
Sequence:CCGGCGAGAATTTAGTAGAGCCATACTCGAGTATGGCTCTACTAAATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015630.2-254s1c1
Sequence:CCGGGCAGAGAGCAACGTCAACTATCTCGAGATAGTTGACGTTGCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015630.2-2122s1c1
Sequence:CCGGCCACACCACTACAAACCACTTCTCGAGAAGTGGTTTGTAGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-1092s21c1
Sequence:CCGGGACATTGCCTGTGATCAATAACTCGAGTTATTGATCACAGGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-522s21c1
Sequence:CCGGCGAAGATGATTACCTTATTAACTCGAGTTAATAAGGTAATCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-353s21c1
Sequence:CCGGACAACGAGCAACCAGATTATGCTCGAGCATAATCTGGTTGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-1404s21c1
Sequence:CCGGGGTCATAATGGACCGAATATCCTCGAGGATATTCGGTCCATTATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015630
VALIDATED
EPC2 MISSION shRNA Lentiviral Transduction Particles
enhancer of polycomb homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015630.2-1236s1c1
Sequence:CCGGGCCAGTATTATGCTCCTCGTTCTCGAGAACGAGGAGCATAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015630.2-734s1c1
Sequence:CCGGCGAGAATTTAGTAGAGCCATACTCGAGTATGGCTCTACTAAATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015630.2-254s1c1
Sequence:CCGGGCAGAGAGCAACGTCAACTATCTCGAGATAGTTGACGTTGCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015630.2-2122s1c1
Sequence:CCGGCCACACCACTACAAACCACTTCTCGAGAAGTGGTTTGTAGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-1092s21c1
Sequence:CCGGGACATTGCCTGTGATCAATAACTCGAGTTATTGATCACAGGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-522s21c1
Sequence:CCGGCGAAGATGATTACCTTATTAACTCGAGTTAATAAGGTAATCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-353s21c1
Sequence:CCGGACAACGAGCAACCAGATTATGCTCGAGCATAATCTGGTTGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015630.3-1404s21c1
Sequence:CCGGGGTCATAATGGACCGAATATCCTCGAGGATATTCGGTCCATTATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172663
EPC2 MISSION shRNA Bacterial Glycerol Stock
enhancer of polycomb homolog 2 (Drosophila)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172663.2-3563s1c1
Sequence:CCGGCCAGGTATGTATTGCATCATACTCGAGTATGATGCAATACATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172663.2-1191s1c1
Sequence:CCGGGCAACCCTTCATAATGGAAATCTCGAGATTTCCATTATGAAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172663.2-582s1c1
Sequence:CCGGCCCAAGCAGTTCATTCATATTCTCGAGAATATGAATGAACTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172663.2-2517s1c1
Sequence:CCGGCCTGTCAATGTGCATATCAATCTCGAGATTGATATGCACATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172663.4-1385s21c1
Sequence:CCGGGACATTGCCTGTGATCAATAACTCGAGTTATTGATCACAGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172663.4-1700s21c1
Sequence:CCGGGGTCATAATGGACCGAATATCCTCGAGGATATTCGGTCCATTATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172663
EPC2 MISSION shRNA shRNA Plasmid DNA
enhancer of polycomb homolog 2 (Drosophila)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172663.2-3563s1c1
Sequence:CCGGCCAGGTATGTATTGCATCATACTCGAGTATGATGCAATACATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172663.2-1191s1c1
Sequence:CCGGGCAACCCTTCATAATGGAAATCTCGAGATTTCCATTATGAAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172663.2-582s1c1
Sequence:CCGGCCCAAGCAGTTCATTCATATTCTCGAGAATATGAATGAACTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172663.2-2517s1c1
Sequence:CCGGCCTGTCAATGTGCATATCAATCTCGAGATTGATATGCACATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172663.4-1385s21c1
Sequence:CCGGGACATTGCCTGTGATCAATAACTCGAGTTATTGATCACAGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172663.4-1700s21c1
Sequence:CCGGGGTCATAATGGACCGAATATCCTCGAGGATATTCGGTCCATTATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172663
EPC2 MISSION shRNA Lentiviral Transduction Particles
enhancer of polycomb homolog 2 (Drosophila)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172663.2-3563s1c1
Sequence:CCGGCCAGGTATGTATTGCATCATACTCGAGTATGATGCAATACATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172663.2-1191s1c1
Sequence:CCGGGCAACCCTTCATAATGGAAATCTCGAGATTTCCATTATGAAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172663.2-582s1c1
Sequence:CCGGCCCAAGCAGTTCATTCATATTCTCGAGAATATGAATGAACTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172663.2-2517s1c1
Sequence:CCGGCCTGTCAATGTGCATATCAATCTCGAGATTGATATGCACATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172663.4-1385s21c1
Sequence:CCGGGACATTGCCTGTGATCAATAACTCGAGTTATTGATCACAGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172663.4-1700s21c1
Sequence:CCGGGGTCATAATGGACCGAATATCCTCGAGGATATTCGGTCCATTATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks