EMAIL THIS PAGE TO A FRIEND

EPCAM

epithelial cell adhesion molecule

88 Gene Product Result for
Synonyms: DIAR5 EGP-2 EGP314 EGP40 ESA HNPCC8 KS1/4 KSA M4S1 MIC18 MK-1 TACSTD1 TROP1
UniProtKB ID: P16422, P18180, Q6FG26, Q6FG49, Q96C47, Q9UCD0
Gene ID:
Human(4072) Summary: This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]
Mouse(17075) epithelial cell adhesion molecule
Rat(171577) epithelial cell adhesion molecule
naked mole-rat(101706078) epithelial cell adhesion molecule
sheep(100302339) epithelial cell adhesion molecule
Zebrafish(406454) epithelial cell adhesion molecule
domestic cat(101081794) epithelial cell adhesion molecule
dog(481360) epithelial cell adhesion molecule
cow(514039) epithelial cell adhesion molecule
chicken(421292) epithelial cell adhesion molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA026761 Anti-EPCAM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA067463 Anti-EPCAM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4501796 Anti-TACD1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB1100086 Anti-TACSTD1 (212-225) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100085 Anti-TACSTD1 (81-95) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1400156 Anti-TACSTD1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1400157 Anti-TACSTD1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4700423 Monoclonal Anti-CD326 antibody produced in mouse clone VU-1D9, purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4700424 Monoclonal Anti-CD326-FITC antibody produced in mouse clone VU-1D9, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700425 Monoclonal Anti-CD326-PE antibody produced in mouse clone VU-1D9, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB3300054 Monoclonal Anti-EpCAM antibody produced in mouse clone 2G1, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
SAB4200473 Monoclonal Anti-EpCAM ICD antibody produced in mouse ~1.0 mg/mL, clone 4A7, purified immunoglobulin human, mouse
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002354 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037851 MISSION® esiRNA esiRNA human TACSTD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002354 Rosetta Predictions human pricing
NM_138541 Rosetta Predictions rat pricing
NM_008532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213583 predicted 319
2 SASI_Hs02_00333689 predicted 356
3 SASI_Hs01_00213584 predicted 281
4 SASI_Hs01_00213585 predicted 474
5 SASI_Hs01_00213586 predicted 1287
6 SASI_Hs01_00213587 predicted 245
7 SASI_Hs02_00333690 predicted 1270
8 SASI_Hs01_00213588 predicted 438
9 SASI_Hs01_00213589 predicted 468
10 SASI_Hs01_00213590 predicted 687
11 SASI_Hs01_00213591 predicted 440
12 SASI_Hs01_00213592 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122397 predicted 204
2 SASI_Rn01_00122398 predicted 809
3 SASI_Rn01_00122399 predicted 524
4 SASI_Rn01_00122400 predicted 631
5 SASI_Rn01_00122401 predicted 695
6 SASI_Rn01_00122402 predicted 566
7 SASI_Rn01_00122403 predicted 520
8 SASI_Rn01_00122405 predicted 907
9 SASI_Rn01_00122406 predicted 325
10 SASI_Rn02_00268179 predicted 1062
11 SASI_Rn01_00122404 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314115 predicted 880
2 SASI_Mm02_00314116 predicted 979
3 SASI_Mm02_00314117 predicted 1023
4 SASI_Mm02_00314118 predicted 594
5 SASI_Mm02_00314119 predicted 634
6 SASI_Mm02_00314120 predicted 1297
7 SASI_Mm02_00314121 predicted 1268
8 SASI_Mm02_00314122 predicted 590
9 SASI_Mm02_00314123 predicted 679
10 SASI_Mm02_00314124 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008532
EPCAM MISSION shRNA Bacterial Glycerol Stock
epithelial cell adhesion molecule
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008532.2-1585s21c1
Sequence:CCGGACCGGCATTACCGATCGTAAACTCGAGTTTACGATCGGTAATGCCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008532.2-1347s21c1
Sequence:CCGGTATGAGAAGGCTGAGATAAAGCTCGAGCTTTATCTCAGCCTTCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008532.2-1505s21c1
Sequence:CCGGGGTTACTGCTTTGATAGTTACCTCGAGGTAACTATCAAAGCAGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008532.2-1550s21c1
Sequence:CCGGGTGAAATTTGTACTCGTAAATCTCGAGATTTACGAGTACAAATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008532.1-1306s1c1
Sequence:CCGGGCCTGCAAAGTTAAGAGAGTTCTCGAGAACTCTCTTAACTTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-962s1c1
Sequence:CCGGCCTGGTTATATCTACAAGGAACTCGAGTTCCTTGTAGATATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-621s1c1
Sequence:CCGGCGATATAAGCTGAATCAGAAACTCGAGTTTCTGATTCAGCTTATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-521s1c1
Sequence:CCGGGAGGACCTACTGGATCATCATCTCGAGATGATGATCCAGTAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-223s1c1
Sequence:CCGGCTCTGAATGAATATGGTGAATCTCGAGATTCACCATATTCATTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008532
EPCAM MISSION shRNA shRNA Plasmid DNA
epithelial cell adhesion molecule
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008532.2-1585s21c1
Sequence:CCGGACCGGCATTACCGATCGTAAACTCGAGTTTACGATCGGTAATGCCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008532.2-1347s21c1
Sequence:CCGGTATGAGAAGGCTGAGATAAAGCTCGAGCTTTATCTCAGCCTTCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008532.2-1505s21c1
Sequence:CCGGGGTTACTGCTTTGATAGTTACCTCGAGGTAACTATCAAAGCAGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008532.2-1550s21c1
Sequence:CCGGGTGAAATTTGTACTCGTAAATCTCGAGATTTACGAGTACAAATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008532.1-1306s1c1
Sequence:CCGGGCCTGCAAAGTTAAGAGAGTTCTCGAGAACTCTCTTAACTTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-962s1c1
Sequence:CCGGCCTGGTTATATCTACAAGGAACTCGAGTTCCTTGTAGATATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-621s1c1
Sequence:CCGGCGATATAAGCTGAATCAGAAACTCGAGTTTCTGATTCAGCTTATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-521s1c1
Sequence:CCGGGAGGACCTACTGGATCATCATCTCGAGATGATGATCCAGTAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-223s1c1
Sequence:CCGGCTCTGAATGAATATGGTGAATCTCGAGATTCACCATATTCATTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008532
EPCAM MISSION shRNA Lentiviral Transduction Particles
epithelial cell adhesion molecule
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008532.2-1585s21c1
Sequence:CCGGACCGGCATTACCGATCGTAAACTCGAGTTTACGATCGGTAATGCCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008532.2-1347s21c1
Sequence:CCGGTATGAGAAGGCTGAGATAAAGCTCGAGCTTTATCTCAGCCTTCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008532.2-1505s21c1
Sequence:CCGGGGTTACTGCTTTGATAGTTACCTCGAGGTAACTATCAAAGCAGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008532.2-1550s21c1
Sequence:CCGGGTGAAATTTGTACTCGTAAATCTCGAGATTTACGAGTACAAATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008532.1-1306s1c1
Sequence:CCGGGCCTGCAAAGTTAAGAGAGTTCTCGAGAACTCTCTTAACTTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-962s1c1
Sequence:CCGGCCTGGTTATATCTACAAGGAACTCGAGTTCCTTGTAGATATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-621s1c1
Sequence:CCGGCGATATAAGCTGAATCAGAAACTCGAGTTTCTGATTCAGCTTATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-521s1c1
Sequence:CCGGGAGGACCTACTGGATCATCATCTCGAGATGATGATCCAGTAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008532.1-223s1c1
Sequence:CCGGCTCTGAATGAATATGGTGAATCTCGAGATTCACCATATTCATTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002354
VALIDATED
EPCAM MISSION shRNA Bacterial Glycerol Stock
epithelial cell adhesion molecule
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002354.1-1159s1c1
Sequence:CCGGGCAAATGGACACAAATTACAACTCGAGTTGTAATTTGTGTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002354.1-281s1c1
Sequence:CCGGGCCGTAAACTGCTTTGTGAATCTCGAGATTCACAAAGCAGTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002354.1-1033s1c1
Sequence:CCGGGCTGGTTATTTCCAGAAAGAACTCGAGTTCTTTCTGGAAATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002354.1-694s1c1
Sequence:CCGGGCGTTATCAACTGGATCCAAACTCGAGTTTGGATCCAGTTGATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002354.1-693s1c1
Sequence:CCGGCGCGTTATCAACTGGATCCAACTCGAGTTGGATCCAGTTGATAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002354
VALIDATED
EPCAM MISSION shRNA shRNA Plasmid DNA
epithelial cell adhesion molecule
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002354.1-1159s1c1
Sequence:CCGGGCAAATGGACACAAATTACAACTCGAGTTGTAATTTGTGTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002354.1-281s1c1
Sequence:CCGGGCCGTAAACTGCTTTGTGAATCTCGAGATTCACAAAGCAGTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002354.1-1033s1c1
Sequence:CCGGGCTGGTTATTTCCAGAAAGAACTCGAGTTCTTTCTGGAAATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002354.1-694s1c1
Sequence:CCGGGCGTTATCAACTGGATCCAAACTCGAGTTTGGATCCAGTTGATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002354.1-693s1c1
Sequence:CCGGCGCGTTATCAACTGGATCCAACTCGAGTTGGATCCAGTTGATAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002354
VALIDATED
EPCAM MISSION shRNA Lentiviral Transduction Particles
epithelial cell adhesion molecule
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002354.1-1159s1c1
Sequence:CCGGGCAAATGGACACAAATTACAACTCGAGTTGTAATTTGTGTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002354.1-281s1c1
Sequence:CCGGGCCGTAAACTGCTTTGTGAATCTCGAGATTCACAAAGCAGTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002354.1-1033s1c1
Sequence:CCGGGCTGGTTATTTCCAGAAAGAACTCGAGTTCTTTCTGGAAATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002354.1-694s1c1
Sequence:CCGGGCGTTATCAACTGGATCCAAACTCGAGTTTGGATCCAGTTGATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002354.1-693s1c1
Sequence:CCGGCGCGTTATCAACTGGATCCAACTCGAGTTGGATCCAGTTGATAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks