EMAIL THIS PAGE TO A FRIEND

EPDR1

ependymin related 1

160 Gene Product Result for
Synonyms: EPDR MERP-1 MERP1 UCC1
UniProtKB ID: Q9UM22, A8K4C0, C9JYS3, Q06BL0, Q99M77
Gene ID:
Human(54749) Summary: The protein encoded by this gene is a type II transmembrane protein that is similar to two families of cell adhesion molecules, the protocadherins and ependymins. This protein may play a role in calcium-dependent cell adhesion. This protein is glycosylated, and the orthologous mouse protein is localized to the lysosome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, Aug 2011]
Mouse(105298) ependymin related protein 1 (zebrafish)
Rat(291180) ependymin related 1
Zebrafish(436689) ependymin related protein 1
cow(615376) ependymin related protein 1 (zebrafish)
domestic cat(101100548) ependymin related protein 1 (zebrafish)
dog(609403) ependymin related protein 1 (zebrafish)
chicken(420731) ependymin related protein 1 (zebrafish)
sheep(101107276) ependymin related protein 1 (zebrafish)
naked mole-rat(101714446) ependymin related protein 1 (zebrafish)
domestic guinea pig(100717189) ependymin related protein 1 (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017549 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017549 Rosetta Predictions human pricing
NM_001007625 Rosetta Predictions rat pricing
NM_134065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114094 predicted 998
2 SASI_Hs01_00114095 predicted 835
3 SASI_Hs02_00350182 predicted 950
4 SASI_Hs01_00114097 predicted 911
5 SASI_Hs01_00114098 predicted 932
6 SASI_Hs01_00114099 predicted 1031
7 SASI_Hs01_00114100 predicted 698
8 SASI_Hs01_00114101 predicted 861
9 SASI_Hs02_00350183 predicted 1115
10 SASI_Hs02_00350184 predicted 871
11 SASI_Hs01_00114092 predicted 673
12 SASI_Hs01_00114093 predicted 1133
13 SASI_Hs01_00114096 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081266 predicted 1194
2 SASI_Rn01_00081267 predicted 1299
3 SASI_Rn01_00081268 predicted 1008
4 SASI_Rn01_00081269 predicted 644
5 SASI_Rn01_00081270 predicted 1181
6 SASI_Rn01_00081271 predicted 515
7 SASI_Rn01_00081272 predicted 1141
8 SASI_Rn01_00081273 predicted 710
9 SASI_Rn01_00081274 predicted 551
10 SASI_Rn02_00198718 predicted 1072
11 SASI_Rn01_00081265 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053860 predicted 1202
2 SASI_Mm01_00053861 predicted 537
3 SASI_Mm01_00053862 predicted 960
4 SASI_Mm01_00053863 predicted 1197
5 SASI_Mm01_00053864 predicted 952
6 SASI_Mm01_00053865 predicted 1026
7 SASI_Mm01_00053866 predicted 1322
8 SASI_Mm01_00053867 predicted 706
9 SASI_Mm01_00053868 predicted 966
10 SASI_Mm01_00053869 predicted 1161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134065
VALIDATED
EPDR1 MISSION shRNA Bacterial Glycerol Stock
ependymin related 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-811s1c1
Sequence:CCGGCGGTTCTTTGATGTGCAGCTACTCGAGTAGCTGCACATCAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-570s1c1
Sequence:CCGGCACCAAACAGTGTGCAAAGATCTCGAGATCTTTGCACACTGTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-1432s1c1
Sequence:CCGGCGAAGTAATGATTCCTCTAAACTCGAGTTTAGAGGAATCATTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-737s1c1
Sequence:CCGGGCGTTTATACAGCCAAGGATTCTCGAGAATCCTTGGCTGTATAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-783s1c1
Sequence:CCGGCAGGAACTACACTGTGGTCATCTCGAGATGACCACAGTGTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-702s21c1
Sequence:CCGGGAAGAACAGCAAGATCCTATGCTCGAGCATAGGATCTTGCTGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134065.3-1430s21c1
Sequence:CCGGCGAAGTAATGATTCCTCTAAACTCGAGTTTAGAGGAATCATTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-735s21c1
Sequence:CCGGGCGTTTATACAGCCAAGGATTCTCGAGAATCCTTGGCTGTATAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-568s21c1
Sequence:CCGGCACCAAACAGTGTGCAAAGATCTCGAGATCTTTGCACACTGTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-781s21c1
Sequence:CCGGCAGGAACTACACTGTGGTCATCTCGAGATGACCACAGTGTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-534s21c1
Sequence:CCGGATAAGGAGGGAGTGATGTTTCCTCGAGGAAACATCACTCCCTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134065
VALIDATED
EPDR1 MISSION shRNA shRNA Plasmid DNA
ependymin related 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-811s1c1
Sequence:CCGGCGGTTCTTTGATGTGCAGCTACTCGAGTAGCTGCACATCAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-570s1c1
Sequence:CCGGCACCAAACAGTGTGCAAAGATCTCGAGATCTTTGCACACTGTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-1432s1c1
Sequence:CCGGCGAAGTAATGATTCCTCTAAACTCGAGTTTAGAGGAATCATTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-737s1c1
Sequence:CCGGGCGTTTATACAGCCAAGGATTCTCGAGAATCCTTGGCTGTATAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-783s1c1
Sequence:CCGGCAGGAACTACACTGTGGTCATCTCGAGATGACCACAGTGTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-702s21c1
Sequence:CCGGGAAGAACAGCAAGATCCTATGCTCGAGCATAGGATCTTGCTGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134065.3-1430s21c1
Sequence:CCGGCGAAGTAATGATTCCTCTAAACTCGAGTTTAGAGGAATCATTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-735s21c1
Sequence:CCGGGCGTTTATACAGCCAAGGATTCTCGAGAATCCTTGGCTGTATAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-568s21c1
Sequence:CCGGCACCAAACAGTGTGCAAAGATCTCGAGATCTTTGCACACTGTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-781s21c1
Sequence:CCGGCAGGAACTACACTGTGGTCATCTCGAGATGACCACAGTGTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-534s21c1
Sequence:CCGGATAAGGAGGGAGTGATGTTTCCTCGAGGAAACATCACTCCCTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134065
VALIDATED
EPDR1 MISSION shRNA Lentiviral Transduction Particles
ependymin related 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-811s1c1
Sequence:CCGGCGGTTCTTTGATGTGCAGCTACTCGAGTAGCTGCACATCAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-570s1c1
Sequence:CCGGCACCAAACAGTGTGCAAAGATCTCGAGATCTTTGCACACTGTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-1432s1c1
Sequence:CCGGCGAAGTAATGATTCCTCTAAACTCGAGTTTAGAGGAATCATTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-737s1c1
Sequence:CCGGGCGTTTATACAGCCAAGGATTCTCGAGAATCCTTGGCTGTATAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134065.2-783s1c1
Sequence:CCGGCAGGAACTACACTGTGGTCATCTCGAGATGACCACAGTGTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-702s21c1
Sequence:CCGGGAAGAACAGCAAGATCCTATGCTCGAGCATAGGATCTTGCTGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134065.3-1430s21c1
Sequence:CCGGCGAAGTAATGATTCCTCTAAACTCGAGTTTAGAGGAATCATTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-735s21c1
Sequence:CCGGGCGTTTATACAGCCAAGGATTCTCGAGAATCCTTGGCTGTATAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-568s21c1
Sequence:CCGGCACCAAACAGTGTGCAAAGATCTCGAGATCTTTGCACACTGTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-781s21c1
Sequence:CCGGCAGGAACTACACTGTGGTCATCTCGAGATGACCACAGTGTAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134065.3-534s21c1
Sequence:CCGGATAAGGAGGGAGTGATGTTTCCTCGAGGAAACATCACTCCCTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017549
VALIDATED
EPDR1 MISSION shRNA Bacterial Glycerol Stock
ependymin related 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017549.1-873s1c1
Sequence:CCGGGCATCTATACAGTCAAGGATTCTCGAGAATCCTTGACTGTATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017549.1-639s1c1
Sequence:CCGGCCTGCAAGAGATTATTTGAATCTCGAGATTCAAATAATCTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017549.1-746s1c1
Sequence:CCGGGATCCTCTTGACATTCCTCAACTCGAGTTGAGGAATGTCAAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017549.1-531s1c1
Sequence:CCGGGCCAGGTTATGTACCAGCAAACTCGAGTTTGCTGGTACATAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017549.3-905s21c1
Sequence:CCGGCAGGAAACCTTTACCATAAACCTCGAGGTTTATGGTAAAGGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017549.3-772s21c1
Sequence:CCGGCACCTTTGAAGACCAGTACTCCTCGAGGAGTACTGGTCTTCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017549.3-844s21c1
Sequence:CCGGGTCAGCTAGATCCTATGAAACCTCGAGGTTTCATAGGATCTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017549
VALIDATED
EPDR1 MISSION shRNA shRNA Plasmid DNA
ependymin related 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017549.1-873s1c1
Sequence:CCGGGCATCTATACAGTCAAGGATTCTCGAGAATCCTTGACTGTATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017549.1-639s1c1
Sequence:CCGGCCTGCAAGAGATTATTTGAATCTCGAGATTCAAATAATCTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017549.1-746s1c1
Sequence:CCGGGATCCTCTTGACATTCCTCAACTCGAGTTGAGGAATGTCAAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017549.1-531s1c1
Sequence:CCGGGCCAGGTTATGTACCAGCAAACTCGAGTTTGCTGGTACATAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017549.3-905s21c1
Sequence:CCGGCAGGAAACCTTTACCATAAACCTCGAGGTTTATGGTAAAGGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017549.3-772s21c1
Sequence:CCGGCACCTTTGAAGACCAGTACTCCTCGAGGAGTACTGGTCTTCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017549.3-844s21c1
Sequence:CCGGGTCAGCTAGATCCTATGAAACCTCGAGGTTTCATAGGATCTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017549
VALIDATED
EPDR1 MISSION shRNA Lentiviral Transduction Particles
ependymin related 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017549.1-873s1c1
Sequence:CCGGGCATCTATACAGTCAAGGATTCTCGAGAATCCTTGACTGTATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017549.1-639s1c1
Sequence:CCGGCCTGCAAGAGATTATTTGAATCTCGAGATTCAAATAATCTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017549.1-746s1c1
Sequence:CCGGGATCCTCTTGACATTCCTCAACTCGAGTTGAGGAATGTCAAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017549.1-531s1c1
Sequence:CCGGGCCAGGTTATGTACCAGCAAACTCGAGTTTGCTGGTACATAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017549.3-905s21c1
Sequence:CCGGCAGGAAACCTTTACCATAAACCTCGAGGTTTATGGTAAAGGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017549.3-772s21c1
Sequence:CCGGCACCTTTGAAGACCAGTACTCCTCGAGGAGTACTGGTCTTCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017549.3-844s21c1
Sequence:CCGGGTCAGCTAGATCCTATGAAACCTCGAGGTTTCATAGGATCTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks