EMAIL THIS PAGE TO A FRIEND

EPG5

ectopic P-granules autophagy protein 5 homolog (C. elegans)

95 Gene Product Result for
Synonyms: HEEW1 KIAA1632 VICIS hEPG5
UniProtKB ID: Q9HCE0, A2BDF3, Q9H8C8
Gene ID:
Mouse(100502841) ectopic P-granules autophagy protein 5 homolog (C. elegans)
Rat(364902) ectopic P-granules autophagy protein 5 homolog (C. elegans)
chicken(416379) ectopic P-granules autophagy protein 5 homolog (C. elegans)
dog(480151) ectopic P-granules autophagy protein 5 homolog (C. elegans)
domestic cat(101084910) ectopic P-granules autophagy protein 5 homolog (C. elegans)
cow(529859) ectopic P-granules autophagy protein 5 homolog (C. elegans)
Horse(100068733) ectopic P-granules autophagy protein 5 homolog (C. elegans)
domestic guinea pig(100727325) ectopic P-granules autophagy protein 5 homolog (C. elegans)
naked mole-rat(101704724) ectopic P-granules autophagy protein 5 homolog (C. elegans)
sheep(101109319) ectopic P-granules autophagy protein 5 homolog (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020964 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_038864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_038864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_038864 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020964 Rosetta Predictions human pricing
XM_001056478 Rosetta Predictions rat pricing
XM_344703 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070273 predicted 6225
2 SASI_Hs02_00354394 predicted 7410
3 SASI_Hs01_00070275 predicted 1787
4 SASI_Hs02_00354395 predicted 5429
5 SASI_Hs01_00070276 predicted 2454
6 SASI_Hs01_00070277 predicted 839
7 SASI_Hs01_00070279 predicted 4812
8 SASI_Hs01_00070280 predicted 5768
9 SASI_Hs02_00354396 predicted 2715
10 SASI_Hs01_00070282 predicted 6792
11 SASI_Hs01_00070274 predicted 2128
12 SASI_Hs01_00070278 predicted 4387
13 SASI_Hs01_00070281 predicted 6537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283398 predicted 3614
2 SASI_Rn02_00283399 predicted 2909
3 SASI_Rn02_00283400 predicted 7408
4 SASI_Rn02_00283401 predicted 5760
5 SASI_Rn02_00283402 predicted 7006
6 SASI_Rn02_00283403 predicted 2158
7 SASI_Rn02_00283404 predicted 1728
8 SASI_Rn02_00283405 predicted 2012
9 SASI_Rn02_00283406 predicted 5660
10 SASI_Rn02_00283407 predicted 2039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00133490 predicted 4893
2 SASI_Rn01_00133491 predicted 7037
3 SASI_Rn01_00133492 predicted 621
4 SASI_Rn01_00133493 predicted 2629
5 SASI_Rn01_00133494 predicted 2195
6 SASI_Rn01_00133495 predicted 2481
7 SASI_Rn01_00133496 predicted 6940
8 SASI_Rn01_00133497 predicted 2502
9 SASI_Rn01_00133498 predicted 1697
10 SASI_Rn01_00133499 predicted 6404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020964
EPG5 MISSION shRNA Bacterial Glycerol Stock
ectopic P-granules autophagy protein 5 homolog (C. elegans)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000434550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020964.2-7902s21c1
Sequence:CCGGCACAAGTAACTTTGCTCAATTCTCGAGAATTGAGCAAAGTTACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020964.2-7824s21c1
Sequence:CCGGTGGACCACATACGATAGTTAACTCGAGTTAACTATCGTATGTGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020964.2-5395s21c1
Sequence:CCGGGCTAACCAAGTTCGATCTTAACTCGAGTTAAGATCGAACTTGGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020964.2-7720s21c1
Sequence:CCGGATTGCAAGCCACCCAATTTATCTCGAGATAAATTGGGTGGCTTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020964
EPG5 MISSION shRNA shRNA Plasmid DNA
ectopic P-granules autophagy protein 5 homolog (C. elegans)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000434550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020964.2-7902s21c1
Sequence:CCGGCACAAGTAACTTTGCTCAATTCTCGAGAATTGAGCAAAGTTACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020964.2-7824s21c1
Sequence:CCGGTGGACCACATACGATAGTTAACTCGAGTTAACTATCGTATGTGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020964.2-5395s21c1
Sequence:CCGGGCTAACCAAGTTCGATCTTAACTCGAGTTAAGATCGAACTTGGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020964.2-7720s21c1
Sequence:CCGGATTGCAAGCCACCCAATTTATCTCGAGATAAATTGGGTGGCTTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020964
EPG5 MISSION shRNA Lentiviral Transduction Particles
ectopic P-granules autophagy protein 5 homolog (C. elegans)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000434550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020964.2-7902s21c1
Sequence:CCGGCACAAGTAACTTTGCTCAATTCTCGAGAATTGAGCAAAGTTACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020964.2-7824s21c1
Sequence:CCGGTGGACCACATACGATAGTTAACTCGAGTTAACTATCGTATGTGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020964.2-5395s21c1
Sequence:CCGGGCTAACCAAGTTCGATCTTAACTCGAGTTAAGATCGAACTTGGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020964.2-7720s21c1
Sequence:CCGGATTGCAAGCCACCCAATTTATCTCGAGATAAATTGGGTGGCTTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_038864
VALIDATED
EPG5 MISSION shRNA Bacterial Glycerol Stock
ectopic P-granules autophagy protein 5 homolog (C. elegans)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000137044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-5840s1c1
Sequence:CCGGCGTACCAGAGTGTGCTAAGTTCTCGAGAACTTAGCACACTCTGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-6477s1c1
Sequence:CCGGCTTGACTCTTTACGTCTACTTCTCGAGAAGTAGACGTAAAGAGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-4053s1c1
Sequence:CCGGGCTGTTAGACACAATGCCAAACTCGAGTTTGGCATTGTGTCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-1610s1c1
Sequence:CCGGCCTTTAATAGAGCACGCTATACTCGAGTATAGCGTGCTCTATTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_038864
VALIDATED
EPG5 MISSION shRNA shRNA Plasmid DNA
ectopic P-granules autophagy protein 5 homolog (C. elegans)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000137044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-5840s1c1
Sequence:CCGGCGTACCAGAGTGTGCTAAGTTCTCGAGAACTTAGCACACTCTGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-6477s1c1
Sequence:CCGGCTTGACTCTTTACGTCTACTTCTCGAGAAGTAGACGTAAAGAGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-4053s1c1
Sequence:CCGGGCTGTTAGACACAATGCCAAACTCGAGTTTGGCATTGTGTCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-1610s1c1
Sequence:CCGGCCTTTAATAGAGCACGCTATACTCGAGTATAGCGTGCTCTATTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_038864
VALIDATED
EPG5 MISSION shRNA Lentiviral Transduction Particles
ectopic P-granules autophagy protein 5 homolog (C. elegans)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000137044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-5840s1c1
Sequence:CCGGCGTACCAGAGTGTGCTAAGTTCTCGAGAACTTAGCACACTCTGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-6477s1c1
Sequence:CCGGCTTGACTCTTTACGTCTACTTCTCGAGAAGTAGACGTAAAGAGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-4053s1c1
Sequence:CCGGGCTGTTAGACACAATGCCAAACTCGAGTTTGGCATTGTGTCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_038864.5-1610s1c1
Sequence:CCGGCCTTTAATAGAGCACGCTATACTCGAGTATAGCGTGCTCTATTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks