EMAIL THIS PAGE TO A FRIEND

EPGN

epithelial mitogen

70 Gene Product Result for
Synonyms: ALGV3072 EPG PRO9904
Gene ID:
Human(255324) Summary: The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(71920) epithelial mitogen
Rat(289515) epithelial mitogen
sheep(101105158) epithelial mitogen homolog (mouse)
naked mole-rat(101704232) epithelial mitogen
domestic guinea pig(100715482) epithelial mitogen
chicken(497270) epithelial mitogen homolog (mouse)
dog(611937) epithelial mitogen homolog (mouse)
cow(100295331) epithelial mitogen
domestic cat(101081293) epithelial mitogen homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0783 Mouse Epgn / Epigen ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013442 Rosetta Predictions human pricing
XM_001072006 Rosetta Predictions rat pricing
XM_223280 Rosetta Predictions rat pricing
NM_053087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245533 predicted 228
2 SASI_Hs01_00245534 predicted 215
3 SASI_Hs01_00245535 predicted 222
4 SASI_Hs01_00245536 predicted 198
5 SASI_Hs01_00245537 predicted 218
6 SASI_Hs01_00245538 predicted 234
7 SASI_Hs01_00245539 predicted 215
8 SASI_Hs01_00245532 predicted 200
9 SASI_Hs01_00245540 predicted 229
10 SASI_Hs01_00245541 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337323 predicted 203
2 SASI_Rn02_00337324 predicted 370
3 SASI_Rn02_00337325 predicted 313
4 SASI_Rn02_00337326 predicted 335
5 SASI_Rn02_00337327 predicted 338
6 SASI_Rn02_00337328 predicted 289
7 SASI_Rn02_00337329 predicted 222
8 SASI_Rn02_00337330 predicted 372
9 SASI_Rn02_00337331 predicted 312
10 SASI_Rn02_00337332 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183563 predicted 202
2 SASI_Rn01_00183564 predicted 375
3 SASI_Rn01_00183565 predicted 316
4 SASI_Rn01_00183566 predicted 437
5 SASI_Rn01_00183567 predicted 338
6 SASI_Rn01_00183568 predicted 295
7 SASI_Rn01_00183569 predicted 223
8 SASI_Rn01_00183570 predicted 422
9 SASI_Rn02_00381238 predicted 405
10 SASI_Rn01_00183571 predicted 358
11 SASI_Rn01_00183572 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337575 predicted 584
2 SASI_Mm01_00072523 predicted 716
3 SASI_Mm01_00072525 predicted 654
4 SASI_Mm01_00072526 predicted 465
5 SASI_Mm02_00337576 predicted 570
6 SASI_Mm01_00072528 predicted 641
7 SASI_Mm01_00072530 predicted 265
8 SASI_Mm01_00072531 predicted 304
9 SASI_Mm01_00072532 predicted 243
10 SASI_Mm02_00337577 predicted 479
11 SASI_Mm01_00072524 predicted 594
12 SASI_Mm01_00072527 predicted 582
13 SASI_Mm01_00072529 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013442
EPGN MISSION shRNA Bacterial Glycerol Stock
epithelial mitogen
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-365s1c1
Sequence:CCGGGATTGGTGTTGGATTACTATTCTCGAGAATAGTAATCCAACACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-119s1c1
Sequence:CCGGCGTGACTGTAACACCTCCAATCTCGAGATTGGAGGTGTTACAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-177s1c1
Sequence:CCGGGCCTTGAAGTTCTCACACCTTCTCGAGAAGGTGTGAGAACTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013442.1-665s1c1
Sequence:CCGGCCTATCTCTGTCTGCCCATATCTCGAGATATGGGCAGACAGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-304s1c1
Sequence:CCGGGTGAGCACTTGACTTTAACTTCTCGAGAAGTTAAAGTCAAGTGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013442.1-478s21c1
Sequence:CCGGATAGTTATTCAGGCCCTATAACTCGAGTTATAGGGCCTGAATAACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013442.1-615s21c1
Sequence:CCGGATTTGCCTTCAGTTGTAATAGCTCGAGCTATTACAACTGAAGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013442
EPGN MISSION shRNA shRNA Plasmid DNA
epithelial mitogen
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-365s1c1
Sequence:CCGGGATTGGTGTTGGATTACTATTCTCGAGAATAGTAATCCAACACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-119s1c1
Sequence:CCGGCGTGACTGTAACACCTCCAATCTCGAGATTGGAGGTGTTACAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-177s1c1
Sequence:CCGGGCCTTGAAGTTCTCACACCTTCTCGAGAAGGTGTGAGAACTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013442.1-665s1c1
Sequence:CCGGCCTATCTCTGTCTGCCCATATCTCGAGATATGGGCAGACAGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-304s1c1
Sequence:CCGGGTGAGCACTTGACTTTAACTTCTCGAGAAGTTAAAGTCAAGTGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013442.1-478s21c1
Sequence:CCGGATAGTTATTCAGGCCCTATAACTCGAGTTATAGGGCCTGAATAACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013442.1-615s21c1
Sequence:CCGGATTTGCCTTCAGTTGTAATAGCTCGAGCTATTACAACTGAAGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013442
EPGN MISSION shRNA Lentiviral Transduction Particles
epithelial mitogen
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-365s1c1
Sequence:CCGGGATTGGTGTTGGATTACTATTCTCGAGAATAGTAATCCAACACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-119s1c1
Sequence:CCGGCGTGACTGTAACACCTCCAATCTCGAGATTGGAGGTGTTACAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-177s1c1
Sequence:CCGGGCCTTGAAGTTCTCACACCTTCTCGAGAAGGTGTGAGAACTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013442.1-665s1c1
Sequence:CCGGCCTATCTCTGTCTGCCCATATCTCGAGATATGGGCAGACAGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013442.1-304s1c1
Sequence:CCGGGTGAGCACTTGACTTTAACTTCTCGAGAAGTTAAAGTCAAGTGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013442.1-478s21c1
Sequence:CCGGATAGTTATTCAGGCCCTATAACTCGAGTTATAGGGCCTGAATAACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013442.1-615s21c1
Sequence:CCGGATTTGCCTTCAGTTGTAATAGCTCGAGCTATTACAACTGAAGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053087
EPGN MISSION shRNA Bacterial Glycerol Stock
epithelial mitogen
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-284s1c1
Sequence:CCGGGATGTGAGCATTTGACCCTAACTCGAGTTAGGGTCAAATGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053087.1-206s1c1
Sequence:CCGGGCATTAATGGAGCATGTGCATCTCGAGATGCACATGCTCCATTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053087.1-178s1c2
Sequence:CCGGCCTTGTCTGGAAGACCATAATCTCGAGATTATGGTCTTCCAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-108s1c1
Sequence:CCGGGAGCAACTGGACATTTAACAACTCGAGTTGTTAAATGTCCAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-35s1c1
Sequence:CCGGGCCTCTTGTTCAAAGCAATGACTCGAGTCATTGCTTTGAACAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053087.1-1041s1c1
Sequence:CCGGGCAAACTTCATTCATGTAGTTCTCGAGAACTACATGAATGAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-254s1c1
Sequence:CCGGGCAGATGCTTTACTGGTTATACTCGAGTATAACCAGTAAAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053087.2-421s1c1
Sequence:CCGGCTGAAATCACCCTACATCATCCTCGAGGATGATGTAGGGTGATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053087
EPGN MISSION shRNA shRNA Plasmid DNA
epithelial mitogen
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-284s1c1
Sequence:CCGGGATGTGAGCATTTGACCCTAACTCGAGTTAGGGTCAAATGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053087.1-206s1c1
Sequence:CCGGGCATTAATGGAGCATGTGCATCTCGAGATGCACATGCTCCATTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053087.1-178s1c2
Sequence:CCGGCCTTGTCTGGAAGACCATAATCTCGAGATTATGGTCTTCCAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-108s1c1
Sequence:CCGGGAGCAACTGGACATTTAACAACTCGAGTTGTTAAATGTCCAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-35s1c1
Sequence:CCGGGCCTCTTGTTCAAAGCAATGACTCGAGTCATTGCTTTGAACAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053087.1-1041s1c1
Sequence:CCGGGCAAACTTCATTCATGTAGTTCTCGAGAACTACATGAATGAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-254s1c1
Sequence:CCGGGCAGATGCTTTACTGGTTATACTCGAGTATAACCAGTAAAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053087.2-421s1c1
Sequence:CCGGCTGAAATCACCCTACATCATCCTCGAGGATGATGTAGGGTGATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053087
EPGN MISSION shRNA Lentiviral Transduction Particles
epithelial mitogen
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-284s1c1
Sequence:CCGGGATGTGAGCATTTGACCCTAACTCGAGTTAGGGTCAAATGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053087.1-206s1c1
Sequence:CCGGGCATTAATGGAGCATGTGCATCTCGAGATGCACATGCTCCATTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053087.1-178s1c2
Sequence:CCGGCCTTGTCTGGAAGACCATAATCTCGAGATTATGGTCTTCCAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-108s1c1
Sequence:CCGGGAGCAACTGGACATTTAACAACTCGAGTTGTTAAATGTCCAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-35s1c1
Sequence:CCGGGCCTCTTGTTCAAAGCAATGACTCGAGTCATTGCTTTGAACAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053087.1-1041s1c1
Sequence:CCGGGCAAACTTCATTCATGTAGTTCTCGAGAACTACATGAATGAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053087.1-254s1c1
Sequence:CCGGGCAGATGCTTTACTGGTTATACTCGAGTATAACCAGTAAAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053087.2-421s1c1
Sequence:CCGGCTGAAATCACCCTACATCATCCTCGAGGATGATGTAGGGTGATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks