EMAIL THIS PAGE TO A FRIEND

EPHA10

EPH receptor A10

99 Gene Product Result for
UniProtKB ID: Q5JZY3, A4FU89, J3KPB5, Q6NW42
Gene ID:
Human(284656) Summary: Ephrin receptors, the largest subfamily of receptor tyrosine kinases (RTKs), and their ephrin ligands are important mediators of cell-cell communication regulating cell attachment, shape, and mobility in neuronal and epithelial cells (Aasheim et al., 2005 [PubMed 15777695]
Mouse(230735) Eph receptor A10
Rat(298528) EPH receptor A10
chicken(428219) EPH receptor A10
dog(482471) EPH receptor A10
cow(540439) EPH receptor A10
domestic cat(101091797) EPH receptor A10
sheep(101115582) EPH receptor A10
naked mole-rat(101701975) EPH receptor A10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173641 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU088631 MISSION® esiRNA esiRNA targeting mouse Epha10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004338 Rosetta Predictions human pricing
NM_001099439 Rosetta Predictions human pricing
NM_173641 Rosetta Predictions human pricing
XM_001055964 Rosetta Predictions rat pricing
XM_233522 Rosetta Predictions rat pricing
NM_177671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213493 predicted 893
2 SASI_Hs01_00213494 predicted 1337
3 SASI_Hs01_00213495 predicted 1731
4 SASI_Hs01_00213496 predicted 490
5 SASI_Hs01_00213497 predicted 945
6 SASI_Hs01_00213498 predicted 1731
7 SASI_Hs01_00213499 predicted 1420
8 SASI_Hs01_00213500 predicted 1465
9 SASI_Hs01_00213501 predicted 637
10 SASI_Hs01_00213502 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320759 predicted 326
2 SASI_Hs02_00320760 predicted 292
3 SASI_Hs02_00320761 predicted 466
4 SASI_Hs02_00320762 predicted 344
5 SASI_Hs02_00320763 predicted 254
6 SASI_Hs02_00320764 predicted 684
7 SASI_Hs02_00320765 predicted 678
8 SASI_Hs02_00320766 predicted 642
9 SASI_Hs02_00320767 predicted 310
10 SASI_Hs02_00320768 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092407 predicted 334
2 SASI_Hs01_00092408 predicted 293
3 SASI_Hs01_00092409 predicted 466
4 SASI_Hs01_00092410 predicted 341
5 SASI_Hs02_00368535 predicted 254
6 SASI_Hs01_00092412 predicted 683
7 SASI_Hs02_00368536 predicted 676
8 SASI_Hs01_00092415 predicted 641
9 SASI_Hs01_00092416 predicted 310
10 SASI_Hs02_00368537 predicted 253
11 SASI_Hs01_00092411 predicted 961
12 SASI_Hs01_00092413 predicted 889
13 SASI_Hs01_00092414 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281604 predicted 1538
2 SASI_Rn02_00281605 predicted 2359
3 SASI_Rn02_00281606 predicted 1905
4 SASI_Rn02_00281607 predicted 2637
5 SASI_Rn02_00281608 predicted 1552
6 SASI_Rn02_00281609 predicted 1651
7 SASI_Rn02_00281610 predicted 1565
8 SASI_Rn02_00281611 predicted 259
9 SASI_Rn02_00281612 predicted 2538
10 SASI_Rn02_00281613 predicted 2916
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387834 predicted 2143
2 SASI_Rn02_00387835 predicted 1099
3 SASI_Rn02_00387836 predicted 1838
4 SASI_Rn02_00387837 predicted 1565
5 SASI_Rn02_00387838 predicted 1180
6 SASI_Rn02_00387839 predicted 1113
7 SASI_Rn02_00387840 predicted 1392
8 SASI_Rn02_00387841 predicted 1963
9 SASI_Rn02_00387842 predicted 2242
10 SASI_Rn02_00387843 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029340 predicted 334
2 SASI_Mm01_00029341 predicted 915
3 SASI_Mm01_00029342 predicted 1005
4 SASI_Mm01_00029343 predicted 590
5 SASI_Mm01_00029344 predicted 291
6 SASI_Mm01_00029345 predicted 848
7 SASI_Mm01_00029346 predicted 983
8 SASI_Mm01_00029347 predicted 791
9 SASI_Mm01_00029348 predicted 921
10 SASI_Mm01_00029349 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177671
EPHA10 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-422s1c1
Sequence:CCGGAGAGACCTTCAACGCATACTACTCGAGTAGTATGCGTTGAAGGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-882s1c1
Sequence:CCGGGAACATGGTGACATCTGTGAACTCGAGTTCACAGATGTCACCATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-430s1c1
Sequence:CCGGTCAACGCATACTACCTAGAAACTCGAGTTTCTAGGTAGTATGCGTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-388s1c1
Sequence:CCGGGCAGTAGCATACCAGGTGCCACTCGAGTGGCACCTGGTATGCTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-231s1c1
Sequence:CCGGGAGATTAGTGGCGTGGATGAACTCGAGTTCATCCACGCCACTAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177671.5-468s21c1
Sequence:CCGGCAACGCATACTACCTAGAAACCTCGAGGTTTCTAGGTAGTATGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177671.5-1009s21c1
Sequence:CCGGGTGAAGAGGCAGGAGTAGAAGCTCGAGCTTCTACTCCTGCCTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177671.5-697s21c1
Sequence:CCGGTCGGTGCGTGTCTACTACAAGCTCGAGCTTGTAGTAGACACGCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177671.5-957s21c1
Sequence:CCGGAGGGATGGGATAGGGACATATCTCGAGATATGTCCCTATCCCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177671
EPHA10 MISSION shRNA shRNA Plasmid DNA
EPH receptor A10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-422s1c1
Sequence:CCGGAGAGACCTTCAACGCATACTACTCGAGTAGTATGCGTTGAAGGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-882s1c1
Sequence:CCGGGAACATGGTGACATCTGTGAACTCGAGTTCACAGATGTCACCATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-430s1c1
Sequence:CCGGTCAACGCATACTACCTAGAAACTCGAGTTTCTAGGTAGTATGCGTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-388s1c1
Sequence:CCGGGCAGTAGCATACCAGGTGCCACTCGAGTGGCACCTGGTATGCTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-231s1c1
Sequence:CCGGGAGATTAGTGGCGTGGATGAACTCGAGTTCATCCACGCCACTAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177671.5-468s21c1
Sequence:CCGGCAACGCATACTACCTAGAAACCTCGAGGTTTCTAGGTAGTATGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177671.5-1009s21c1
Sequence:CCGGGTGAAGAGGCAGGAGTAGAAGCTCGAGCTTCTACTCCTGCCTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177671.5-697s21c1
Sequence:CCGGTCGGTGCGTGTCTACTACAAGCTCGAGCTTGTAGTAGACACGCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177671.5-957s21c1
Sequence:CCGGAGGGATGGGATAGGGACATATCTCGAGATATGTCCCTATCCCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177671
EPHA10 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-422s1c1
Sequence:CCGGAGAGACCTTCAACGCATACTACTCGAGTAGTATGCGTTGAAGGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-882s1c1
Sequence:CCGGGAACATGGTGACATCTGTGAACTCGAGTTCACAGATGTCACCATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-430s1c1
Sequence:CCGGTCAACGCATACTACCTAGAAACTCGAGTTTCTAGGTAGTATGCGTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-388s1c1
Sequence:CCGGGCAGTAGCATACCAGGTGCCACTCGAGTGGCACCTGGTATGCTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177671.2-231s1c1
Sequence:CCGGGAGATTAGTGGCGTGGATGAACTCGAGTTCATCCACGCCACTAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177671.5-468s21c1
Sequence:CCGGCAACGCATACTACCTAGAAACCTCGAGGTTTCTAGGTAGTATGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177671.5-1009s21c1
Sequence:CCGGGTGAAGAGGCAGGAGTAGAAGCTCGAGCTTCTACTCCTGCCTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177671.5-697s21c1
Sequence:CCGGTCGGTGCGTGTCTACTACAAGCTCGAGCTTGTAGTAGACACGCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177671.5-957s21c1
Sequence:CCGGAGGGATGGGATAGGGACATATCTCGAGATATGTCCCTATCCCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173641
VALIDATED
EPHA10 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A10
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_173641.1-1498s1c1
Sequence:CCGGCCTGGCCTAAAGGAAGTCATTCTCGAGAATGACTTCCTTTAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173641.1-546s1c1
Sequence:CCGGCCTGGGTGAGCGCAAGATGAACTCGAGTTCATCTTGCGCTCACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_173641.1-891s1c1
Sequence:CCGGCTTCTGCGAAGGTATCCAGTTCTCGAGAACTGGATACCTTCGCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173641.1-199s1c1
Sequence:CCGGTGGACTGCACTGCCAAGTAATCTCGAGATTACTTGGCAGTGCAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173641.1-151s1c1
Sequence:CCGGGAGGAAGTTATCCTCCTGGATCTCGAGATCCAGGAGGATAACTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173641.1-883s1c1
Sequence:CCGGCGTGGTGACTTCTGCGAAGGTCTCGAGACCTTCGCAGAAGTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173641.1-346s1c1
Sequence:CCGGCAGCGCATCTTCGTGGAACTGCTCGAGCAGTTCCACGAAGATGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173641.1-1042s1c1
Sequence:CCGGCCTGAAGTCTTGTGGAGTTTCCTCGAGGAAACTCCACAAGACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-464s21c1
Sequence:CCGGCAACGTCTACTACCTGGAAACCTCGAGGTTTCCAGGTAGTAGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-970s21c1
Sequence:CCGGTGTAGAGCGTAGGTGGCAATTCTCGAGAATTGCCACCTACGCTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173641.2-1187s21c1
Sequence:CCGGGCACAGGCCTTCTCGTTTATTCTCGAGAATAAACGAGAAGGCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-235s21c1
Sequence:CCGGGGACTGCACTGCCAAGTAATGCTCGAGCATTACTTGGCAGTGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-920s21c1
Sequence:CCGGTGGTGACTTCTGCGAAGGTATCTCGAGATACCTTCGCAGAAGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173641
VALIDATED
EPHA10 MISSION shRNA shRNA Plasmid DNA
EPH receptor A10
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_173641.1-1498s1c1
Sequence:CCGGCCTGGCCTAAAGGAAGTCATTCTCGAGAATGACTTCCTTTAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173641.1-546s1c1
Sequence:CCGGCCTGGGTGAGCGCAAGATGAACTCGAGTTCATCTTGCGCTCACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_173641.1-891s1c1
Sequence:CCGGCTTCTGCGAAGGTATCCAGTTCTCGAGAACTGGATACCTTCGCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173641.1-199s1c1
Sequence:CCGGTGGACTGCACTGCCAAGTAATCTCGAGATTACTTGGCAGTGCAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173641.1-151s1c1
Sequence:CCGGGAGGAAGTTATCCTCCTGGATCTCGAGATCCAGGAGGATAACTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173641.1-883s1c1
Sequence:CCGGCGTGGTGACTTCTGCGAAGGTCTCGAGACCTTCGCAGAAGTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173641.1-346s1c1
Sequence:CCGGCAGCGCATCTTCGTGGAACTGCTCGAGCAGTTCCACGAAGATGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173641.1-1042s1c1
Sequence:CCGGCCTGAAGTCTTGTGGAGTTTCCTCGAGGAAACTCCACAAGACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-464s21c1
Sequence:CCGGCAACGTCTACTACCTGGAAACCTCGAGGTTTCCAGGTAGTAGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-970s21c1
Sequence:CCGGTGTAGAGCGTAGGTGGCAATTCTCGAGAATTGCCACCTACGCTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173641.2-1187s21c1
Sequence:CCGGGCACAGGCCTTCTCGTTTATTCTCGAGAATAAACGAGAAGGCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-235s21c1
Sequence:CCGGGGACTGCACTGCCAAGTAATGCTCGAGCATTACTTGGCAGTGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-920s21c1
Sequence:CCGGTGGTGACTTCTGCGAAGGTATCTCGAGATACCTTCGCAGAAGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173641
VALIDATED
EPHA10 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A10
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_173641.1-1498s1c1
Sequence:CCGGCCTGGCCTAAAGGAAGTCATTCTCGAGAATGACTTCCTTTAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173641.1-546s1c1
Sequence:CCGGCCTGGGTGAGCGCAAGATGAACTCGAGTTCATCTTGCGCTCACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_173641.1-891s1c1
Sequence:CCGGCTTCTGCGAAGGTATCCAGTTCTCGAGAACTGGATACCTTCGCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173641.1-199s1c1
Sequence:CCGGTGGACTGCACTGCCAAGTAATCTCGAGATTACTTGGCAGTGCAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173641.1-151s1c1
Sequence:CCGGGAGGAAGTTATCCTCCTGGATCTCGAGATCCAGGAGGATAACTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173641.1-883s1c1
Sequence:CCGGCGTGGTGACTTCTGCGAAGGTCTCGAGACCTTCGCAGAAGTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173641.1-346s1c1
Sequence:CCGGCAGCGCATCTTCGTGGAACTGCTCGAGCAGTTCCACGAAGATGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173641.1-1042s1c1
Sequence:CCGGCCTGAAGTCTTGTGGAGTTTCCTCGAGGAAACTCCACAAGACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-464s21c1
Sequence:CCGGCAACGTCTACTACCTGGAAACCTCGAGGTTTCCAGGTAGTAGACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-970s21c1
Sequence:CCGGTGTAGAGCGTAGGTGGCAATTCTCGAGAATTGCCACCTACGCTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173641.2-1187s21c1
Sequence:CCGGGCACAGGCCTTCTCGTTTATTCTCGAGAATAAACGAGAAGGCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-235s21c1
Sequence:CCGGGGACTGCACTGCCAAGTAATGCTCGAGCATTACTTGGCAGTGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173641.2-920s21c1
Sequence:CCGGTGGTGACTTCTGCGAAGGTATCTCGAGATACCTTCGCAGAAGTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks