EMAIL THIS PAGE TO A FRIEND

EPHA1

EPH receptor A1

71 Gene Product Result for
Synonyms: EPH EPHT EPHT1
UniProtKB ID: P21709, A1L3V3, Q15405
Gene ID:
Human(2041) Summary: This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq, Jul 2008]
Mouse(13835) Eph receptor A1
Rat(312279) Eph receptor A1
chicken(378782) EPH receptor A1
dog(482735) EPH receptor A1
cow(525946) EPH receptor A1
domestic cat(101100200) EPH receptor A1
naked mole-rat(101710388) EPH receptor A1
sheep(101115703) EPH receptor A1
Domestic Rabbit(100338483) EPH receptor A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005232 Rosetta Predictions human pricing
NM_001107858 Rosetta Predictions rat pricing
NM_023580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168172 predicted 2577
2 SASI_Hs01_00168173 predicted 447
3 SASI_Hs01_00168174 predicted 2114
4 SASI_Hs01_00168175 predicted 2291
5 SASI_Hs01_00168178 predicted 1724
6 SASI_Hs02_00339233 predicted 1525
7 SASI_Hs01_00168179 predicted 2103
8 SASI_Hs01_00168180 predicted 1451
9 SASI_Hs02_00339234 predicted 2441
10 SASI_Hs02_00339235 predicted 2333
11 SASI_Hs01_00168176 predicted 2876
12 SASI_Hs01_00168177 predicted 2130
13 SASI_Hs01_00168181 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232975 predicted 1742
2 SASI_Rn02_00232976 predicted 1298
3 SASI_Rn02_00232977 predicted 1256
4 SASI_Rn02_00232978 predicted 1897
5 SASI_Rn02_00232979 predicted 2020
6 SASI_Rn02_00232980 predicted 2079
7 SASI_Rn02_00232981 predicted 1495
8 SASI_Rn02_00232982 predicted 904
9 SASI_Rn02_00232983 predicted 2092
10 SASI_Rn02_00232984 predicted 1711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052742 predicted 2019
2 SASI_Mm01_00052743 predicted 2545
3 SASI_Mm01_00052744 predicted 1747
4 SASI_Mm01_00052745 predicted 2080
5 SASI_Mm01_00052746 predicted 1497
6 SASI_Mm01_00052747 predicted 2095
7 SASI_Mm01_00052748 predicted 1695
8 SASI_Mm01_00052749 predicted 920
9 SASI_Mm01_00052750 predicted 1707
10 SASI_Mm01_00052751 predicted 2277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005232
VALIDATED
EPHA1 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2981s21c1
Sequence:GTACCGGAGCGCATTCTTTGCAGTATTCCTCGAGGAATACTGCAAAGAATGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2575s21c1
Sequence:GTACCGGATGAGCAATCAGGAGGTTATGCTCGAGCATAACCTCCTGATTGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-1303s21c1
Sequence:CCGGGTCAATGGCCTTGAACCTTATCTCGAGATAAGGTTCAAGGCCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-1020s21c1
Sequence:CCGGTACCTGTGAGAGCGGCCATTACTCGAGTAATGGCCGCTCTCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2122s21c1
Sequence:CCGGCAGTTTAGCCACCCGCATATTCTCGAGAATATGCGGGTGGCTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2043s21c1
Sequence:CCGGTGTGGCCATTAAGACCTTAAACTCGAGTTTAAGGTCTTAATGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005232.4-3118s21c1
Sequence:CCGGACTAGGCTATCGGTGCTGCTTCTCGAGAAGCAGCACCGATAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-1727s21c1
Sequence:GTACCGGAGATTGTAGCCGTCATCTTTGCTCGAGCAAAGATGACGGCTACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005232.2-3118s1c1
Sequence:CCGGACTAGGCTATCGGTGCTGCTTCTCGAGAAGCAGCACCGATAGCCTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005232.2-2341s1c1
Sequence:CCGGGCCAGAAACATCTTGGTGAATCTCGAGATTCACCAAGATGTTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005232.2-159s1c1
Sequence:CCGGCGCCAAGGAAGTTACTCTGATCTCGAGATCAGAGTAACTTCCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005232.2-1318s1c1
Sequence:CCGGCCTTATGCCAACTACACCTTTCTCGAGAAAGGTGTAGTTGGCATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005232.2-2176s1c1
Sequence:CCGGCCGATCATGATCATCACAGAACTCGAGTTCTGTGATGATCATGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005232
VALIDATED
EPHA1 MISSION shRNA shRNA Plasmid DNA
EPH receptor A1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2981s21c1
Sequence:GTACCGGAGCGCATTCTTTGCAGTATTCCTCGAGGAATACTGCAAAGAATGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2575s21c1
Sequence:GTACCGGATGAGCAATCAGGAGGTTATGCTCGAGCATAACCTCCTGATTGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-1303s21c1
Sequence:CCGGGTCAATGGCCTTGAACCTTATCTCGAGATAAGGTTCAAGGCCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-1020s21c1
Sequence:CCGGTACCTGTGAGAGCGGCCATTACTCGAGTAATGGCCGCTCTCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2122s21c1
Sequence:CCGGCAGTTTAGCCACCCGCATATTCTCGAGAATATGCGGGTGGCTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2043s21c1
Sequence:CCGGTGTGGCCATTAAGACCTTAAACTCGAGTTTAAGGTCTTAATGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005232.4-3118s21c1
Sequence:CCGGACTAGGCTATCGGTGCTGCTTCTCGAGAAGCAGCACCGATAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-1727s21c1
Sequence:GTACCGGAGATTGTAGCCGTCATCTTTGCTCGAGCAAAGATGACGGCTACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005232.2-3118s1c1
Sequence:CCGGACTAGGCTATCGGTGCTGCTTCTCGAGAAGCAGCACCGATAGCCTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005232.2-2341s1c1
Sequence:CCGGGCCAGAAACATCTTGGTGAATCTCGAGATTCACCAAGATGTTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005232.2-159s1c1
Sequence:CCGGCGCCAAGGAAGTTACTCTGATCTCGAGATCAGAGTAACTTCCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005232.2-1318s1c1
Sequence:CCGGCCTTATGCCAACTACACCTTTCTCGAGAAAGGTGTAGTTGGCATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005232.2-2176s1c1
Sequence:CCGGCCGATCATGATCATCACAGAACTCGAGTTCTGTGATGATCATGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005232
VALIDATED
EPHA1 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2981s21c1
Sequence:GTACCGGAGCGCATTCTTTGCAGTATTCCTCGAGGAATACTGCAAAGAATGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2575s21c1
Sequence:GTACCGGATGAGCAATCAGGAGGTTATGCTCGAGCATAACCTCCTGATTGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-1303s21c1
Sequence:CCGGGTCAATGGCCTTGAACCTTATCTCGAGATAAGGTTCAAGGCCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-1020s21c1
Sequence:CCGGTACCTGTGAGAGCGGCCATTACTCGAGTAATGGCCGCTCTCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2122s21c1
Sequence:CCGGCAGTTTAGCCACCCGCATATTCTCGAGAATATGCGGGTGGCTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-2043s21c1
Sequence:CCGGTGTGGCCATTAAGACCTTAAACTCGAGTTTAAGGTCTTAATGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005232.4-3118s21c1
Sequence:CCGGACTAGGCTATCGGTGCTGCTTCTCGAGAAGCAGCACCGATAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005232.4-1727s21c1
Sequence:GTACCGGAGATTGTAGCCGTCATCTTTGCTCGAGCAAAGATGACGGCTACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005232.2-3118s1c1
Sequence:CCGGACTAGGCTATCGGTGCTGCTTCTCGAGAAGCAGCACCGATAGCCTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005232.2-2341s1c1
Sequence:CCGGGCCAGAAACATCTTGGTGAATCTCGAGATTCACCAAGATGTTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005232.2-159s1c1
Sequence:CCGGCGCCAAGGAAGTTACTCTGATCTCGAGATCAGAGTAACTTCCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005232.2-1318s1c1
Sequence:CCGGCCTTATGCCAACTACACCTTTCTCGAGAAAGGTGTAGTTGGCATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005232.2-2176s1c1
Sequence:CCGGCCGATCATGATCATCACAGAACTCGAGTTCTGTGATGATCATGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023580
EPHA1 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023580.4-1738s21c1
Sequence:CCGGAGCTCTGCTGATCGGGATTTACTCGAGTAAATCCCGATCAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023580.4-211s21c1
Sequence:CCGGGTGGAGTGAGGTGCAACAAATCTCGAGATTTGTTGCACCTCACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023580.4-1302s21c1
Sequence:CCGGACTACACATTTACCGTCAAATCTCGAGATTTGACGGTAAATGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-1740s1c1
Sequence:CCGGGCTCTGCTGATCGGGATTTATCTCGAGATAAATCCCGATCAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-863s1c1
Sequence:CCGGCTATGAAGAAAGCAGTGGAAACTCGAGTTTCCACTGCTTTCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-2109s1c1
Sequence:CCGGCCACACATTCTACGCCTAGAACTCGAGTTCTAGGCGTAGAATGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-2385s1c1
Sequence:CCGGGATGACTTTGACGGCACCTATCTCGAGATAGGTGCCGTCAAAGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-1293s1c1
Sequence:CCGGCCTTACGCCAACTACACATTTCTCGAGAAATGTGTAGTTGGCGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023580
EPHA1 MISSION shRNA shRNA Plasmid DNA
EPH receptor A1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023580.4-1738s21c1
Sequence:CCGGAGCTCTGCTGATCGGGATTTACTCGAGTAAATCCCGATCAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023580.4-211s21c1
Sequence:CCGGGTGGAGTGAGGTGCAACAAATCTCGAGATTTGTTGCACCTCACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023580.4-1302s21c1
Sequence:CCGGACTACACATTTACCGTCAAATCTCGAGATTTGACGGTAAATGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-1740s1c1
Sequence:CCGGGCTCTGCTGATCGGGATTTATCTCGAGATAAATCCCGATCAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-863s1c1
Sequence:CCGGCTATGAAGAAAGCAGTGGAAACTCGAGTTTCCACTGCTTTCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-2109s1c1
Sequence:CCGGCCACACATTCTACGCCTAGAACTCGAGTTCTAGGCGTAGAATGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-2385s1c1
Sequence:CCGGGATGACTTTGACGGCACCTATCTCGAGATAGGTGCCGTCAAAGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-1293s1c1
Sequence:CCGGCCTTACGCCAACTACACATTTCTCGAGAAATGTGTAGTTGGCGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023580
EPHA1 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023580.4-1738s21c1
Sequence:CCGGAGCTCTGCTGATCGGGATTTACTCGAGTAAATCCCGATCAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023580.4-211s21c1
Sequence:CCGGGTGGAGTGAGGTGCAACAAATCTCGAGATTTGTTGCACCTCACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023580.4-1302s21c1
Sequence:CCGGACTACACATTTACCGTCAAATCTCGAGATTTGACGGTAAATGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-1740s1c1
Sequence:CCGGGCTCTGCTGATCGGGATTTATCTCGAGATAAATCCCGATCAGCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-863s1c1
Sequence:CCGGCTATGAAGAAAGCAGTGGAAACTCGAGTTTCCACTGCTTTCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-2109s1c1
Sequence:CCGGCCACACATTCTACGCCTAGAACTCGAGTTCTAGGCGTAGAATGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-2385s1c1
Sequence:CCGGGATGACTTTGACGGCACCTATCTCGAGATAGGTGCCGTCAAAGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023580.2-1293s1c1
Sequence:CCGGCCTTACGCCAACTACACATTTCTCGAGAAATGTGTAGTTGGCGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks