EMAIL THIS PAGE TO A FRIEND

EPHA2

EPH receptor A2

103 Gene Product Result for
Synonyms: ARCC2 CTPA CTPP1 CTRCT6 ECK
UniProtKB ID: P29317, Q8N3Z2
Gene ID:
Human(1969) Summary: This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
Mouse(13836) Eph receptor A2
Rat(366492) Eph receptor A2
naked mole-rat(101714513) EPH receptor A2
sheep(101110575) EPH receptor A2
Domestic Rabbit(100343518) EPH receptor A2
Zebrafish(30689) eph receptor A2
chicken(771550) EPH receptor A2
cow(512798) EPH receptor A2
Horse(100053644) EPH receptor A2
domestic cat(101085481) EPH receptor A2
dog(487421) EPH receptor A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301754 Anti-EPHA2 affinity isolated antibody human
immunohistochemistry pricing
E3282 Anti-EPHA2 (566-580) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4500731 Anti-EPHA2 antibody produced in rabbit affinity isolated antibody rat, human
ELISA, immunofluorescence, western blot pricing
SAB1410325 Anti-EPHA2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5500095 Anti-EPHA2 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP169, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB1302596 ANTI-MOUSE EPHA2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504171 Anti-phospho-EPHA2/3 (pTyr588/596) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB4504172 Anti-phospho-EPHB1/2 (pTyr594/604) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
E1026 Monoclonal Anti-EphA2 (Eck, Sek-2) antibody produced in mouse clone D7, purified immunoglobulin, buffered aqueous glycerol solution rat, bovine, canine (predicted), human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
WH0001969M1 Monoclonal Anti-EPHA2 antibody produced in mouse clone 6F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403760 Monoclonal Anti-EPHA2 antibody produced in mouse clone 1E3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004431 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004431 Rosetta Predictions human pricing
NM_001108977 Rosetta Predictions rat pricing
NM_010139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026514 predicted 2874
2 SASI_Hs01_00026515 predicted 413
3 SASI_Hs02_00337600 predicted 3024
4 SASI_Hs01_00026516 predicted 2091
5 SASI_Hs01_00026517 predicted 1557
6 SASI_Hs01_00026518 predicted 2902
7 SASI_Hs01_00026519 predicted 2073
8 SASI_Hs01_00026520 predicted 539
9 SASI_Hs01_00026521 predicted 1529
10 SASI_Hs01_00026522 predicted 1206
11 SASI_Hs01_00026523 predicted 2501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243954 predicted 2069
2 SASI_Rn02_00243955 predicted 2693
3 SASI_Rn02_00243956 predicted 270
4 SASI_Rn02_00243957 predicted 3129
5 SASI_Rn02_00243958 predicted 2703
6 SASI_Rn02_00243959 predicted 512
7 SASI_Rn02_00243960 predicted 2557
8 SASI_Rn02_00243961 predicted 2567
9 SASI_Rn02_00243962 predicted 2366
10 SASI_Rn02_00243963 predicted 1764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043571 predicted 2859
2 SASI_Mm01_00043572 predicted 2236
3 SASI_Mm01_00043573 predicted 2224
4 SASI_Mm01_00043574 predicted 1869
5 SASI_Mm02_00317875 predicted 2285
6 SASI_Mm01_00043575 predicted 2641
7 SASI_Mm01_00043576 predicted 2474
8 SASI_Mm01_00043577 predicted 3003
9 SASI_Mm01_00043578 predicted 2153
10 SASI_Mm02_00317876 predicted 2571
11 SASI_Mm01_00043579 predicted 3124
12 SASI_Mm01_00043580 predicted 2882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004431
VALIDATED
EPHA2 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004431.2-487s21c1
Sequence:GTACCGGAGACTTTCAACCTCTACTATGCTCGAGCATAGTAGAGGTTGAAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004431.2-1536s21c1
Sequence:CCGGTGGAAGTACGAGGTCACTTACCTCGAGGTAAGTGACCTCGTACTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004431.2-2171s21c1
Sequence:CCGGAGAGGGCGTCATCTCCAAATACTCGAGTATTTGGAGATGACGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004431.2-3351s21c1
Sequence:CCGGTCGGACAGACATATAGGATATCTCGAGATATCCTATATGTCTGTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004431.2-2881s21c1
Sequence:CCGGCCATCAAGATGCAGCAGTATACTCGAGTATACTGCTGCATCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004431.2-1567s21c1
Sequence:CCGGGAGACTCCAACAGCTACAATGCTCGAGCATTGTAGCTGTTGGAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004431.2-1544s1c1
Sequence:CCGGCGAGGTCACTTACCGCAAGAACTCGAGTTCTTGCGGTAAGTGACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004431.2-325s1c1
Sequence:CCGGCGATCTACATGTACTCCGTGTCTCGAGACACGGAGTACATGTAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004431.2-3804s1c1
Sequence:CCGGGATAAGTTTCTATTCTGTCAGCTCGAGCTGACAGAATAGAAACTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-3352s1c1
Sequence:CCGGCGGACAGACATATAGGATATTCTCGAGAATATCCTATATGTCTGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004431.2-716s1c1
Sequence:CCGGCGTCCGTGTCTACTACAAGAACTCGAGTTCTTGTAGTAGACACGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-2881s1c1
Sequence:CCGGCCATCAAGATGCAGCAGTATACTCGAGTATACTGCTGCATCTTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-2183s1c1
Sequence:CCGGCTCCAAATACAAGCCCATGATCTCGAGATCATGGGCTTGTATTTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-413s1c1
Sequence:CCGGGCGTATCTTCATTGAGCTCAACTCGAGTTGAGCTCAATGAAGATACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004431
VALIDATED
EPHA2 MISSION shRNA shRNA Plasmid DNA
EPH receptor A2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004431.2-487s21c1
Sequence:GTACCGGAGACTTTCAACCTCTACTATGCTCGAGCATAGTAGAGGTTGAAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004431.2-1536s21c1
Sequence:CCGGTGGAAGTACGAGGTCACTTACCTCGAGGTAAGTGACCTCGTACTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004431.2-2171s21c1
Sequence:CCGGAGAGGGCGTCATCTCCAAATACTCGAGTATTTGGAGATGACGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004431.2-3351s21c1
Sequence:CCGGTCGGACAGACATATAGGATATCTCGAGATATCCTATATGTCTGTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004431.2-2881s21c1
Sequence:CCGGCCATCAAGATGCAGCAGTATACTCGAGTATACTGCTGCATCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004431.2-1567s21c1
Sequence:CCGGGAGACTCCAACAGCTACAATGCTCGAGCATTGTAGCTGTTGGAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004431.2-1544s1c1
Sequence:CCGGCGAGGTCACTTACCGCAAGAACTCGAGTTCTTGCGGTAAGTGACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004431.2-325s1c1
Sequence:CCGGCGATCTACATGTACTCCGTGTCTCGAGACACGGAGTACATGTAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004431.2-3804s1c1
Sequence:CCGGGATAAGTTTCTATTCTGTCAGCTCGAGCTGACAGAATAGAAACTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-3352s1c1
Sequence:CCGGCGGACAGACATATAGGATATTCTCGAGAATATCCTATATGTCTGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004431.2-716s1c1
Sequence:CCGGCGTCCGTGTCTACTACAAGAACTCGAGTTCTTGTAGTAGACACGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-2881s1c1
Sequence:CCGGCCATCAAGATGCAGCAGTATACTCGAGTATACTGCTGCATCTTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-2183s1c1
Sequence:CCGGCTCCAAATACAAGCCCATGATCTCGAGATCATGGGCTTGTATTTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-413s1c1
Sequence:CCGGGCGTATCTTCATTGAGCTCAACTCGAGTTGAGCTCAATGAAGATACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004431
VALIDATED
EPHA2 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004431.2-487s21c1
Sequence:GTACCGGAGACTTTCAACCTCTACTATGCTCGAGCATAGTAGAGGTTGAAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004431.2-1536s21c1
Sequence:CCGGTGGAAGTACGAGGTCACTTACCTCGAGGTAAGTGACCTCGTACTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004431.2-2171s21c1
Sequence:CCGGAGAGGGCGTCATCTCCAAATACTCGAGTATTTGGAGATGACGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004431.2-3351s21c1
Sequence:CCGGTCGGACAGACATATAGGATATCTCGAGATATCCTATATGTCTGTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004431.2-2881s21c1
Sequence:CCGGCCATCAAGATGCAGCAGTATACTCGAGTATACTGCTGCATCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004431.2-1567s21c1
Sequence:CCGGGAGACTCCAACAGCTACAATGCTCGAGCATTGTAGCTGTTGGAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004431.2-1544s1c1
Sequence:CCGGCGAGGTCACTTACCGCAAGAACTCGAGTTCTTGCGGTAAGTGACCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004431.2-325s1c1
Sequence:CCGGCGATCTACATGTACTCCGTGTCTCGAGACACGGAGTACATGTAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004431.2-3804s1c1
Sequence:CCGGGATAAGTTTCTATTCTGTCAGCTCGAGCTGACAGAATAGAAACTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-3352s1c1
Sequence:CCGGCGGACAGACATATAGGATATTCTCGAGAATATCCTATATGTCTGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004431.2-716s1c1
Sequence:CCGGCGTCCGTGTCTACTACAAGAACTCGAGTTCTTGTAGTAGACACGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-2881s1c1
Sequence:CCGGCCATCAAGATGCAGCAGTATACTCGAGTATACTGCTGCATCTTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-2183s1c1
Sequence:CCGGCTCCAAATACAAGCCCATGATCTCGAGATCATGGGCTTGTATTTGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004431.2-413s1c1
Sequence:CCGGGCGTATCTTCATTGAGCTCAACTCGAGTTGAGCTCAATGAAGATACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010139
VALIDATED
EPHA2 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010139.2-3323s21c1
Sequence:CCGGCGATATCGACGAGGGACATTTCTCGAGAAATGTCCCTCGTCGATATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-2119s21c1
Sequence:CCGGGCCAGTTTAGCCACCACAATACTCGAGTATTGTGGTGGCTAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-2588s21c1
Sequence:CCGGCGAGGTCATGAAAGCCATCAACTCGAGTTGATGGCTTTCATGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-1983s21c1
Sequence:CCGGGAGTTTGGAGAGGTCTATAAACTCGAGTTTATAGACCTCTCCAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-180s21c1
Sequence:CCGGGCACAGGGAAAGGAAGTTGTTCTCGAGAACAACTTCCTTTCCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010139.2-180s1c1
Sequence:CCGGGCACAGGGAAAGGAAGTTGTTCTCGAGAACAACTTCCTTTCCCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010139.2-1405s1c1
Sequence:CCGGCCAGCGTCAGTATTAACCAAACTCGAGTTTGGTTAATACTGACGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010139.2-2588s1c1
Sequence:CCGGCGAGGTCATGAAAGCCATCAACTCGAGTTGATGGCTTTCATGACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010139.2-386s1c1
Sequence:CCGGGCGCATCTTTATTGAGCTCAACTCGAGTTGAGCTCAATAAAGATGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010139.2-2119s1c1
Sequence:CCGGGCCAGTTTAGCCACCACAATACTCGAGTATTGTGGTGGCTAAACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010139
VALIDATED
EPHA2 MISSION shRNA shRNA Plasmid DNA
EPH receptor A2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010139.2-3323s21c1
Sequence:CCGGCGATATCGACGAGGGACATTTCTCGAGAAATGTCCCTCGTCGATATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-2119s21c1
Sequence:CCGGGCCAGTTTAGCCACCACAATACTCGAGTATTGTGGTGGCTAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-2588s21c1
Sequence:CCGGCGAGGTCATGAAAGCCATCAACTCGAGTTGATGGCTTTCATGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-1983s21c1
Sequence:CCGGGAGTTTGGAGAGGTCTATAAACTCGAGTTTATAGACCTCTCCAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-180s21c1
Sequence:CCGGGCACAGGGAAAGGAAGTTGTTCTCGAGAACAACTTCCTTTCCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010139.2-180s1c1
Sequence:CCGGGCACAGGGAAAGGAAGTTGTTCTCGAGAACAACTTCCTTTCCCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010139.2-1405s1c1
Sequence:CCGGCCAGCGTCAGTATTAACCAAACTCGAGTTTGGTTAATACTGACGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010139.2-2588s1c1
Sequence:CCGGCGAGGTCATGAAAGCCATCAACTCGAGTTGATGGCTTTCATGACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010139.2-386s1c1
Sequence:CCGGGCGCATCTTTATTGAGCTCAACTCGAGTTGAGCTCAATAAAGATGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010139.2-2119s1c1
Sequence:CCGGGCCAGTTTAGCCACCACAATACTCGAGTATTGTGGTGGCTAAACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010139
VALIDATED
EPHA2 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010139.2-3323s21c1
Sequence:CCGGCGATATCGACGAGGGACATTTCTCGAGAAATGTCCCTCGTCGATATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-2119s21c1
Sequence:CCGGGCCAGTTTAGCCACCACAATACTCGAGTATTGTGGTGGCTAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-2588s21c1
Sequence:CCGGCGAGGTCATGAAAGCCATCAACTCGAGTTGATGGCTTTCATGACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-1983s21c1
Sequence:CCGGGAGTTTGGAGAGGTCTATAAACTCGAGTTTATAGACCTCTCCAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010139.2-180s21c1
Sequence:CCGGGCACAGGGAAAGGAAGTTGTTCTCGAGAACAACTTCCTTTCCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010139.2-180s1c1
Sequence:CCGGGCACAGGGAAAGGAAGTTGTTCTCGAGAACAACTTCCTTTCCCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010139.2-1405s1c1
Sequence:CCGGCCAGCGTCAGTATTAACCAAACTCGAGTTTGGTTAATACTGACGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010139.2-2588s1c1
Sequence:CCGGCGAGGTCATGAAAGCCATCAACTCGAGTTGATGGCTTTCATGACCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010139.2-386s1c1
Sequence:CCGGGCGCATCTTTATTGAGCTCAACTCGAGTTGAGCTCAATAAAGATGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010139.2-2119s1c1
Sequence:CCGGGCCAGTTTAGCCACCACAATACTCGAGTATTGTGGTGGCTAAACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)