EMAIL THIS PAGE TO A FRIEND

EPHA3

EPH receptor A3

157 Gene Product Result for
Synonyms: EK4 ETK ETK1 HEK HEK4 TYRO4
UniProtKB ID: P29320, Q9H2V3, Q9H2V4
Gene ID:
Human(2042) Summary: This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(13837) Eph receptor A3
Rat(29210) Eph receptor A3
chicken(396402) EPH receptor A3
cow(537951) EPH receptor A3
Horse(100054527) EPH receptor A3
domestic cat(101085310) EPH receptor A3
dog(487930) EPH receptor A3
sheep(101122744) EPH receptor A3
Domestic Rabbit(100344496) EPH receptor A3
naked mole-rat(101721765) EPH receptor A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0944 Phosphotyrosine EPHA3 / Ephrin Type-A Receptor 3 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005233 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005233 Rosetta Predictions human pricing
NM_182644 Rosetta Predictions human pricing
NM_031564 Rosetta Predictions rat pricing
NM_010140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100840 predicted 989
2 SASI_Hs02_00339236 predicted 312
3 SASI_Hs01_00100843 predicted 1066
4 SASI_Hs01_00100844 predicted 1550
5 SASI_Hs01_00100845 predicted 725
6 SASI_Hs01_00100846 predicted 829
7 SASI_Hs01_00100847 predicted 1294
8 SASI_Hs01_00100848 predicted 1425
9 SASI_Hs01_00100849 predicted 1593
10 SASI_Hs02_00339237 predicted 280
11 SASI_Hs01_00100841 predicted 829
12 SASI_Hs01_00100842 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143937 predicted 989
2 SASI_Hs02_00370802 predicted 311
3 SASI_Hs01_00143940 predicted 1067
4 SASI_Hs01_00143941 predicted 1555
5 SASI_Hs01_00143942 predicted 729
6 SASI_Hs01_00143943 predicted 835
7 SASI_Hs01_00143944 predicted 1295
8 SASI_Hs01_00143945 predicted 1423
9 SASI_Hs01_00143946 predicted 1586
10 SASI_Hs02_00370803 predicted 282
11 SASI_Hs01_00143938 predicted 697
12 SASI_Hs01_00143939 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115754 predicted 1342
2 SASI_Rn01_00115755 predicted 2792
3 SASI_Rn01_00115756 predicted 1813
4 SASI_Rn01_00115757 predicted 1464
5 SASI_Rn01_00115758 predicted 2457
6 SASI_Rn01_00115760 predicted 1248
7 SASI_Rn01_00115761 predicted 407
8 SASI_Rn01_00115762 predicted 2785
9 SASI_Rn01_00115763 predicted 1583
10 SASI_Rn02_00264787 predicted 2446
11 SASI_Rn01_00115759 predicted 2738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147702 predicted 1419
2 SASI_Mm01_00147703 predicted 1934
3 SASI_Mm01_00147704 predicted 301
4 SASI_Mm01_00147705 predicted 1762
5 SASI_Mm01_00147707 predicted 2854
6 SASI_Mm01_00147708 predicted 2492
7 SASI_Mm01_00147709 predicted 2189
8 SASI_Mm01_00147710 predicted 2523
9 SASI_Mm02_00317877 predicted 1925
10 SASI_Mm02_00317878 predicted 3154
11 SASI_Mm01_00147706 predicted 2540
12 SASI_Mm01_00147711 predicted 2596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005233
VALIDATED
EPHA3 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A3
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-4735s1c1
Sequence:CCGGGCTCTATTGATACTCTTTCTACTCGAGTAGAAAGAGTATCAATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-1787s1c1
Sequence:CCGGGCCGCAAGTTTGAGTTTGAAACTCGAGTTTCAAACTCAAACTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-2263s1c1
Sequence:CCGGCCCAATATCATTCGACTGGAACTCGAGTTCCAGTCGAATGATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-1442s1c1
Sequence:CCGGCCTTTGAGATTGATGCCGTTACTCGAGTAACGGCATCAATCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-301s1c1
Sequence:CCGGCCTTCCAATGAAGTCAATCTACTCGAGTAGATTGACTTCATTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-670s1c1
Sequence:CCGGGATGAAAGTTTCACTCAAATGCTCGAGCATTTGAGTGAAACTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005233.3-4758s1c1
Sequence:CCGGGCTGATATGATCTTGAGTATACTCGAGTATACTCAAGATCATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-542s1c1
Sequence:CCGGGCAATAGCATTCCATTGGTTTCTCGAGAAACCAATGGAATGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-2077s1c1
Sequence:CCGGGCCACCAACATATCCATTGATCTCGAGATCAATGGATATGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005233.3-5524s1c1
Sequence:CCGGCATGATGTTATGTACCATATGCTCGAGCATATGGTACATAACATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-1726s1c1
Sequence:CCGGCCTGACACTATATACGTATTCCTCGAGGAATACGTATATAGTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005233.5-3642s21c1
Sequence:CCGGCAAACTATCTGGCCATATTTACTCGAGTAAATATGGCCAGATAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-670s21c1
Sequence:CCGGGATGAAAGTTTCACTCAAATGCTCGAGCATTTGAGTGAAACTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-1787s21c1
Sequence:CCGGGCCGCAAGTTTGAGTTTGAAACTCGAGTTTCAAACTCAAACTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-301s21c1
Sequence:CCGGCCTTCCAATGAAGTCAATCTACTCGAGTAGATTGACTTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-1726s21c1
Sequence:CCGGCCTGACACTATATACGTATTCCTCGAGGAATACGTATATAGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005233
VALIDATED
EPHA3 MISSION shRNA shRNA Plasmid DNA
EPH receptor A3
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-4735s1c1
Sequence:CCGGGCTCTATTGATACTCTTTCTACTCGAGTAGAAAGAGTATCAATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-1787s1c1
Sequence:CCGGGCCGCAAGTTTGAGTTTGAAACTCGAGTTTCAAACTCAAACTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-2263s1c1
Sequence:CCGGCCCAATATCATTCGACTGGAACTCGAGTTCCAGTCGAATGATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-1442s1c1
Sequence:CCGGCCTTTGAGATTGATGCCGTTACTCGAGTAACGGCATCAATCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-301s1c1
Sequence:CCGGCCTTCCAATGAAGTCAATCTACTCGAGTAGATTGACTTCATTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-670s1c1
Sequence:CCGGGATGAAAGTTTCACTCAAATGCTCGAGCATTTGAGTGAAACTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005233.3-4758s1c1
Sequence:CCGGGCTGATATGATCTTGAGTATACTCGAGTATACTCAAGATCATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-542s1c1
Sequence:CCGGGCAATAGCATTCCATTGGTTTCTCGAGAAACCAATGGAATGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-2077s1c1
Sequence:CCGGGCCACCAACATATCCATTGATCTCGAGATCAATGGATATGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005233.3-5524s1c1
Sequence:CCGGCATGATGTTATGTACCATATGCTCGAGCATATGGTACATAACATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-1726s1c1
Sequence:CCGGCCTGACACTATATACGTATTCCTCGAGGAATACGTATATAGTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005233.5-3642s21c1
Sequence:CCGGCAAACTATCTGGCCATATTTACTCGAGTAAATATGGCCAGATAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-670s21c1
Sequence:CCGGGATGAAAGTTTCACTCAAATGCTCGAGCATTTGAGTGAAACTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-1787s21c1
Sequence:CCGGGCCGCAAGTTTGAGTTTGAAACTCGAGTTTCAAACTCAAACTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-301s21c1
Sequence:CCGGCCTTCCAATGAAGTCAATCTACTCGAGTAGATTGACTTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-1726s21c1
Sequence:CCGGCCTGACACTATATACGTATTCCTCGAGGAATACGTATATAGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005233
VALIDATED
EPHA3 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A3
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-4735s1c1
Sequence:CCGGGCTCTATTGATACTCTTTCTACTCGAGTAGAAAGAGTATCAATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-1787s1c1
Sequence:CCGGGCCGCAAGTTTGAGTTTGAAACTCGAGTTTCAAACTCAAACTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-2263s1c1
Sequence:CCGGCCCAATATCATTCGACTGGAACTCGAGTTCCAGTCGAATGATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-1442s1c1
Sequence:CCGGCCTTTGAGATTGATGCCGTTACTCGAGTAACGGCATCAATCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-301s1c1
Sequence:CCGGCCTTCCAATGAAGTCAATCTACTCGAGTAGATTGACTTCATTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-670s1c1
Sequence:CCGGGATGAAAGTTTCACTCAAATGCTCGAGCATTTGAGTGAAACTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005233.3-4758s1c1
Sequence:CCGGGCTGATATGATCTTGAGTATACTCGAGTATACTCAAGATCATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-542s1c1
Sequence:CCGGGCAATAGCATTCCATTGGTTTCTCGAGAAACCAATGGAATGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005233.3-2077s1c1
Sequence:CCGGGCCACCAACATATCCATTGATCTCGAGATCAATGGATATGTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005233.3-5524s1c1
Sequence:CCGGCATGATGTTATGTACCATATGCTCGAGCATATGGTACATAACATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005233.3-1726s1c1
Sequence:CCGGCCTGACACTATATACGTATTCCTCGAGGAATACGTATATAGTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005233.5-3642s21c1
Sequence:CCGGCAAACTATCTGGCCATATTTACTCGAGTAAATATGGCCAGATAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-670s21c1
Sequence:CCGGGATGAAAGTTTCACTCAAATGCTCGAGCATTTGAGTGAAACTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-1787s21c1
Sequence:CCGGGCCGCAAGTTTGAGTTTGAAACTCGAGTTTCAAACTCAAACTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-301s21c1
Sequence:CCGGCCTTCCAATGAAGTCAATCTACTCGAGTAGATTGACTTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005233.5-1726s21c1
Sequence:CCGGCCTGACACTATATACGTATTCCTCGAGGAATACGTATATAGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010140
VALIDATED
EPHA3 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-3014s1c1
Sequence:CCGGGCACCATTAAAGCTCTAGAAACTCGAGTTTCTAGAGCTTTAATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-187s1c1
Sequence:CCGGCCTTCCAACGAAGTTAATCTACTCGAGTAGATTAACTTCGTTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-1673s1c1
Sequence:CCGGGCCGCAAATTTGAATTTGAAACTCGAGTTTCAAATTCAAATTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-1611s1c1
Sequence:CCGGGCCAGATACTACTTATGTCTTCTCGAGAAGACATAAGTAGTATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-1898s1c1
Sequence:CCGGCCTATGTTGATCCACATACATCTCGAGATGTATGTGGATCAACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010140.1-1611s1c2
Sequence:CCGGGCCAGATACTACTTATGTCTTCTCGAGAAGACATAAGTAGTATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010140.3-3331s21c1
Sequence:CCGGGTGTAGAGCCATTGATCATTACTCGAGTAATGATCAATGGCTCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-493s21c1
Sequence:CCGGATGATGATCATGGCGTCAAATCTCGAGATTTGACGCCATGATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-1957s21c1
Sequence:CCGGAGTTGGATGCCACCAATATATCTCGAGATATATTGGTGGCATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-3536s21c1
Sequence:CCGGCTACCTTATCACGTTAGTATTCTCGAGAATACTAACGTGATAAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-1662s21c1
Sequence:CCGGGGAACCAACAGCCGCAAATTTCTCGAGAAATTTGCGGCTGTTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010140
VALIDATED
EPHA3 MISSION shRNA shRNA Plasmid DNA
EPH receptor A3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-3014s1c1
Sequence:CCGGGCACCATTAAAGCTCTAGAAACTCGAGTTTCTAGAGCTTTAATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-187s1c1
Sequence:CCGGCCTTCCAACGAAGTTAATCTACTCGAGTAGATTAACTTCGTTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-1673s1c1
Sequence:CCGGGCCGCAAATTTGAATTTGAAACTCGAGTTTCAAATTCAAATTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-1611s1c1
Sequence:CCGGGCCAGATACTACTTATGTCTTCTCGAGAAGACATAAGTAGTATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-1898s1c1
Sequence:CCGGCCTATGTTGATCCACATACATCTCGAGATGTATGTGGATCAACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010140.1-1611s1c2
Sequence:CCGGGCCAGATACTACTTATGTCTTCTCGAGAAGACATAAGTAGTATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010140.3-3331s21c1
Sequence:CCGGGTGTAGAGCCATTGATCATTACTCGAGTAATGATCAATGGCTCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-493s21c1
Sequence:CCGGATGATGATCATGGCGTCAAATCTCGAGATTTGACGCCATGATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-1957s21c1
Sequence:CCGGAGTTGGATGCCACCAATATATCTCGAGATATATTGGTGGCATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-3536s21c1
Sequence:CCGGCTACCTTATCACGTTAGTATTCTCGAGAATACTAACGTGATAAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-1662s21c1
Sequence:CCGGGGAACCAACAGCCGCAAATTTCTCGAGAAATTTGCGGCTGTTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010140
VALIDATED
EPHA3 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-3014s1c1
Sequence:CCGGGCACCATTAAAGCTCTAGAAACTCGAGTTTCTAGAGCTTTAATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-187s1c1
Sequence:CCGGCCTTCCAACGAAGTTAATCTACTCGAGTAGATTAACTTCGTTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-1673s1c1
Sequence:CCGGGCCGCAAATTTGAATTTGAAACTCGAGTTTCAAATTCAAATTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-1611s1c1
Sequence:CCGGGCCAGATACTACTTATGTCTTCTCGAGAAGACATAAGTAGTATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010140.1-1898s1c1
Sequence:CCGGCCTATGTTGATCCACATACATCTCGAGATGTATGTGGATCAACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010140.1-1611s1c2
Sequence:CCGGGCCAGATACTACTTATGTCTTCTCGAGAAGACATAAGTAGTATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010140.3-3331s21c1
Sequence:CCGGGTGTAGAGCCATTGATCATTACTCGAGTAATGATCAATGGCTCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-493s21c1
Sequence:CCGGATGATGATCATGGCGTCAAATCTCGAGATTTGACGCCATGATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-1957s21c1
Sequence:CCGGAGTTGGATGCCACCAATATATCTCGAGATATATTGGTGGCATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-3536s21c1
Sequence:CCGGCTACCTTATCACGTTAGTATTCTCGAGAATACTAACGTGATAAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010140.3-1662s21c1
Sequence:CCGGGGAACCAACAGCCGCAAATTTCTCGAGAAATTTGCGGCTGTTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks