EMAIL THIS PAGE TO A FRIEND

EPHA5

EPH receptor A5

219 Gene Product Result for
Synonyms: CEK7 EHK-1 EHK1 EK7 HEK7 TYRO4
UniProtKB ID: P54756, Q7Z3F2
Gene ID:
Human(2044) Summary: This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Mouse(13839) Eph receptor A5
Rat(79208) EPH receptor A5
chicken(395997) EPH receptor A5
dog(100684553) EPH receptor A5
Horse(100066188) EPH receptor A5
cow(538224) EPH receptor A5
cow(101909073) EPH receptor A5
domestic cat(101080281) EPH receptor A5
sheep(101119989) EPH receptor A5
Domestic Rabbit(100345523) EPH receptor A5
naked mole-rat(101708081) EPH receptor A5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU161011 MISSION® esiRNA esiRNA human EPHA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004439 siRNAs that have been validated in the lab human pricing
NM_182472 Rosetta Predictions human pricing
XM_001075222 Rosetta Predictions rat pricing
XM_341201 Rosetta Predictions rat pricing
NM_007937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004439 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039027 validated 2153
1 SASI_Hs01_00039025 validated 2502
1 SASI_Hs01_00039026 validated 2587
2 SASI_Hs01_00039028 predicted 1576
3 SASI_Hs01_00039029 predicted 477
4 SASI_Hs01_00039030 predicted 413
5 SASI_Hs02_00337611 predicted 2105
6 SASI_Hs01_00039034 predicted 1317
7 SASI_Hs02_00337612 predicted 2396
8 SASI_Hs02_00337613 predicted 2471
9 SASI_Hs02_00337614 predicted 2869
10 SASI_Hs01_00039031 predicted 2237
11 SASI_Hs01_00039032 predicted 1371
12 SASI_Hs01_00039033 predicted 2199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073120 predicted 2439
2 SASI_Hs01_00073121 predicted 2524
3 SASI_Hs01_00073123 predicted 1575
4 SASI_Hs01_00073124 predicted 480
5 SASI_Hs01_00073125 predicted 410
6 SASI_Hs02_00370492 predicted 2039
7 SASI_Hs01_00073129 predicted 1319
8 SASI_Hs02_00370493 predicted 2326
9 SASI_Hs02_00370494 predicted 2403
10 SASI_Hs02_00370495 predicted 2797
11 SASI_Hs01_00073122 predicted 2077
12 SASI_Hs01_00073126 predicted 2164
13 SASI_Hs01_00073127 predicted 1372
14 SASI_Hs01_00073128 predicted 2138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348870 predicted 510
2 SASI_Rn02_00348871 predicted 1502
3 SASI_Rn02_00348872 predicted 2564
4 SASI_Rn02_00348873 predicted 1487
5 SASI_Rn02_00348874 predicted 2858
6 SASI_Rn02_00348875 predicted 2098
7 SASI_Rn02_00348876 predicted 1560
8 SASI_Rn02_00348877 predicted 1925
9 SASI_Rn02_00348878 predicted 1941
10 SASI_Rn02_00348879 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392573 predicted 287
2 SASI_Rn02_00392574 predicted 318
3 SASI_Rn02_00392575 predicted 323
4 SASI_Rn02_00392576 predicted 508
5 SASI_Rn02_00392577 predicted 441
6 SASI_Rn02_00392578 predicted 291
7 SASI_Rn02_00392579 predicted 479
8 SASI_Rn02_00392580 predicted 443
9 SASI_Rn02_00392581 predicted 253
10 SASI_Rn02_00392582 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312776 predicted 2849
2 SASI_Mm02_00312777 predicted 2087
3 SASI_Mm01_00095542 predicted 1205
4 SASI_Mm01_00095543 predicted 2351
5 SASI_Mm02_00312778 predicted 1253
6 SASI_Mm01_00095544 predicted 1941
7 SASI_Mm01_00095545 predicted 1056
8 SASI_Mm01_00095546 predicted 1417
9 SASI_Mm01_00095547 predicted 3246
10 SASI_Mm01_00095548 predicted 1976
11 SASI_Mm01_00095541 predicted 921
12 SASI_Mm01_00095549 predicted 1881
13 SASI_Mm01_00095550 predicted 2350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004439
VALIDATED
EPHA5 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A5
Human
21 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-3190s1c1
Sequence:CCGGTGAATGATTCTGCACTTTGTACTCGAGTACAAAGTGCAGAATCATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.3-1412s1c1
Sequence:CCGGCGGCAGTATGTGTCTGTAAATCTCGAGATTTACAGACACATACTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-2790s1c1
Sequence:CCGGGCTGGCAGAAAGAGCGAAATACTCGAGTATTTCGCTCTTTCTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-1346s1c1
Sequence:CCGGGCTCACACAAACTATACCTTTCTCGAGAAAGGTATAGTTTGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-1981s1c1
Sequence:CCGGGCCAGGAGTAAGAACTTACATCTCGAGATGTAAGTTCTTACTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.4-2594s1c1
Sequence:CCGGGCAATAGCTTTCCGAAAGTTTCTCGAGAAACTTTCGGAAAGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004439.4-3167s1c1
Sequence:CCGGCATGTAAATGTCGCTTCTTCACTCGAGTGAAGAAGCGACATTTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004439.4-3186s1c1
Sequence:CCGGCAAGTGAATGATTCTGCACTTCTCGAGAAGTGCAGAATCATTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.4-226s1c1
Sequence:CCGGCGAAGTGAATTTATTGGATTCCTCGAGGAATCCAATAAATTCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.4-2172s1c1
Sequence:CCGGCCCTTAAAGTAGGCTATACTGCTCGAGCAGTATAGCCTACTTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004439.4-486s1c1
Sequence:CCGGCCTGTAAGGAAACCTTTAATACTCGAGTATTAAAGGTTTCCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-3035s21c1
Sequence:CCGGGCATCCTGCAGAGTATCTAATCTCGAGATTAGATACTCTGCAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-478s21c1
Sequence:CCGGTATCCACACATACCAAGTATGCTCGAGCATACTTGGTATGTGTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004439.4-3164s21c1
Sequence:GTACCGGCTTCATGTAAATGTCGCTTCTCTCGAGAGAAGCGACATTTACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004439.4-2028s21c1
Sequence:CCGGATCAAGCTGTCCACGAATTTGCTCGAGCAAATTCGTGGACAGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.4-1884s21c1
Sequence:CCGGTTGCCCATCCAAGCCTAATATCTCGAGATATTAGGCTTGGATGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.4-1582s21c1
Sequence:CCGGAGAGACCAGCTACACGATTATCTCGAGATAATCGTGTAGCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.4-722s21c1
Sequence:CCGGTCTGTGCGTGTATACTATAAACTCGAGTTTATAGTATACACGCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-1926s21c1
Sequence:CCGGCTGTGACAGTGGGAGTCATTTCTCGAGAAATGACTCCCACTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-2390s21c1
Sequence:CCGGCATCCTAACATCATCCATTTACTCGAGTAAATGGATGATGTTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-751s21c1
Sequence:CCGGTGATCTTGGTGACCGTGTTATCTCGAGATAACACGGTCACCAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004439
VALIDATED
EPHA5 MISSION shRNA shRNA Plasmid DNA
EPH receptor A5
Human
21 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-3190s1c1
Sequence:CCGGTGAATGATTCTGCACTTTGTACTCGAGTACAAAGTGCAGAATCATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.3-1412s1c1
Sequence:CCGGCGGCAGTATGTGTCTGTAAATCTCGAGATTTACAGACACATACTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-2790s1c1
Sequence:CCGGGCTGGCAGAAAGAGCGAAATACTCGAGTATTTCGCTCTTTCTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-1346s1c1
Sequence:CCGGGCTCACACAAACTATACCTTTCTCGAGAAAGGTATAGTTTGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-1981s1c1
Sequence:CCGGGCCAGGAGTAAGAACTTACATCTCGAGATGTAAGTTCTTACTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.4-2594s1c1
Sequence:CCGGGCAATAGCTTTCCGAAAGTTTCTCGAGAAACTTTCGGAAAGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004439.4-3167s1c1
Sequence:CCGGCATGTAAATGTCGCTTCTTCACTCGAGTGAAGAAGCGACATTTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004439.4-3186s1c1
Sequence:CCGGCAAGTGAATGATTCTGCACTTCTCGAGAAGTGCAGAATCATTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.4-226s1c1
Sequence:CCGGCGAAGTGAATTTATTGGATTCCTCGAGGAATCCAATAAATTCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.4-2172s1c1
Sequence:CCGGCCCTTAAAGTAGGCTATACTGCTCGAGCAGTATAGCCTACTTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004439.4-486s1c1
Sequence:CCGGCCTGTAAGGAAACCTTTAATACTCGAGTATTAAAGGTTTCCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-3035s21c1
Sequence:CCGGGCATCCTGCAGAGTATCTAATCTCGAGATTAGATACTCTGCAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-478s21c1
Sequence:CCGGTATCCACACATACCAAGTATGCTCGAGCATACTTGGTATGTGTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004439.4-3164s21c1
Sequence:GTACCGGCTTCATGTAAATGTCGCTTCTCTCGAGAGAAGCGACATTTACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004439.4-2028s21c1
Sequence:CCGGATCAAGCTGTCCACGAATTTGCTCGAGCAAATTCGTGGACAGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.4-1884s21c1
Sequence:CCGGTTGCCCATCCAAGCCTAATATCTCGAGATATTAGGCTTGGATGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.4-1582s21c1
Sequence:CCGGAGAGACCAGCTACACGATTATCTCGAGATAATCGTGTAGCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.4-722s21c1
Sequence:CCGGTCTGTGCGTGTATACTATAAACTCGAGTTTATAGTATACACGCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-1926s21c1
Sequence:CCGGCTGTGACAGTGGGAGTCATTTCTCGAGAAATGACTCCCACTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-2390s21c1
Sequence:CCGGCATCCTAACATCATCCATTTACTCGAGTAAATGGATGATGTTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-751s21c1
Sequence:CCGGTGATCTTGGTGACCGTGTTATCTCGAGATAACACGGTCACCAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004439
VALIDATED
EPHA5 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A5
Human
21 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-3190s1c1
Sequence:CCGGTGAATGATTCTGCACTTTGTACTCGAGTACAAAGTGCAGAATCATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.3-1412s1c1
Sequence:CCGGCGGCAGTATGTGTCTGTAAATCTCGAGATTTACAGACACATACTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-2790s1c1
Sequence:CCGGGCTGGCAGAAAGAGCGAAATACTCGAGTATTTCGCTCTTTCTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-1346s1c1
Sequence:CCGGGCTCACACAAACTATACCTTTCTCGAGAAAGGTATAGTTTGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004439.3-1981s1c1
Sequence:CCGGGCCAGGAGTAAGAACTTACATCTCGAGATGTAAGTTCTTACTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.4-2594s1c1
Sequence:CCGGGCAATAGCTTTCCGAAAGTTTCTCGAGAAACTTTCGGAAAGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004439.4-3167s1c1
Sequence:CCGGCATGTAAATGTCGCTTCTTCACTCGAGTGAAGAAGCGACATTTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004439.4-3186s1c1
Sequence:CCGGCAAGTGAATGATTCTGCACTTCTCGAGAAGTGCAGAATCATTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.4-226s1c1
Sequence:CCGGCGAAGTGAATTTATTGGATTCCTCGAGGAATCCAATAAATTCACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004439.4-2172s1c1
Sequence:CCGGCCCTTAAAGTAGGCTATACTGCTCGAGCAGTATAGCCTACTTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004439.4-486s1c1
Sequence:CCGGCCTGTAAGGAAACCTTTAATACTCGAGTATTAAAGGTTTCCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-3035s21c1
Sequence:CCGGGCATCCTGCAGAGTATCTAATCTCGAGATTAGATACTCTGCAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-478s21c1
Sequence:CCGGTATCCACACATACCAAGTATGCTCGAGCATACTTGGTATGTGTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004439.4-3164s21c1
Sequence:GTACCGGCTTCATGTAAATGTCGCTTCTCTCGAGAGAAGCGACATTTACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004439.4-2028s21c1
Sequence:CCGGATCAAGCTGTCCACGAATTTGCTCGAGCAAATTCGTGGACAGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.4-1884s21c1
Sequence:CCGGTTGCCCATCCAAGCCTAATATCTCGAGATATTAGGCTTGGATGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.4-1582s21c1
Sequence:CCGGAGAGACCAGCTACACGATTATCTCGAGATAATCGTGTAGCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.4-722s21c1
Sequence:CCGGTCTGTGCGTGTATACTATAAACTCGAGTTTATAGTATACACGCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-1926s21c1
Sequence:CCGGCTGTGACAGTGGGAGTCATTTCTCGAGAAATGACTCCCACTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-2390s21c1
Sequence:CCGGCATCCTAACATCATCCATTTACTCGAGTAAATGGATGATGTTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004439.5-751s21c1
Sequence:CCGGTGATCTTGGTGACCGTGTTATCTCGAGATAACACGGTCACCAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007937
EPHA5 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007937.1-1839s1c1
Sequence:CCGGGCACTTTCATAACGGGCACATCTCGAGATGTGCCCGTTATGAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007937.1-2727s1c1
Sequence:CCGGGCTGGACAAACTGATACGAAACTCGAGTTTCGTATCAGTTTGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007937.1-1880s1c1
Sequence:CCGGCCTATATTGATCCGCACACTTCTCGAGAAGTGTGCGGATCAATATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007937.3-1556s21c1
Sequence:CCGGTCTGTCCGTGTCTACTATAAACTCGAGTTTATAGTAGACACGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007937.3-2229s21c1
Sequence:CCGGTTGCCCATCCAAGCCTAATATCTCGAGATATTAGGCTTGGATGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007937.3-3622s21c1
Sequence:CCGGGCCTTAACCTTTGAGTTTATACTCGAGTATAAACTCAAAGGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007937.3-1947s21c1
Sequence:CCGGAGTCTAAAGAGACCAGTATTACTCGAGTAATACTGGTCTCTTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007937
EPHA5 MISSION shRNA shRNA Plasmid DNA
EPH receptor A5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007937.1-1839s1c1
Sequence:CCGGGCACTTTCATAACGGGCACATCTCGAGATGTGCCCGTTATGAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007937.1-2727s1c1
Sequence:CCGGGCTGGACAAACTGATACGAAACTCGAGTTTCGTATCAGTTTGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007937.1-1880s1c1
Sequence:CCGGCCTATATTGATCCGCACACTTCTCGAGAAGTGTGCGGATCAATATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007937.3-1556s21c1
Sequence:CCGGTCTGTCCGTGTCTACTATAAACTCGAGTTTATAGTAGACACGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007937.3-2229s21c1
Sequence:CCGGTTGCCCATCCAAGCCTAATATCTCGAGATATTAGGCTTGGATGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007937.3-3622s21c1
Sequence:CCGGGCCTTAACCTTTGAGTTTATACTCGAGTATAAACTCAAAGGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007937.3-1947s21c1
Sequence:CCGGAGTCTAAAGAGACCAGTATTACTCGAGTAATACTGGTCTCTTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007937
EPHA5 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007937.1-1839s1c1
Sequence:CCGGGCACTTTCATAACGGGCACATCTCGAGATGTGCCCGTTATGAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007937.1-2727s1c1
Sequence:CCGGGCTGGACAAACTGATACGAAACTCGAGTTTCGTATCAGTTTGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007937.1-1880s1c1
Sequence:CCGGCCTATATTGATCCGCACACTTCTCGAGAAGTGTGCGGATCAATATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007937.3-1556s21c1
Sequence:CCGGTCTGTCCGTGTCTACTATAAACTCGAGTTTATAGTAGACACGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007937.3-2229s21c1
Sequence:CCGGTTGCCCATCCAAGCCTAATATCTCGAGATATTAGGCTTGGATGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007937.3-3622s21c1
Sequence:CCGGGCCTTAACCTTTGAGTTTATACTCGAGTATAAACTCAAAGGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007937.3-1947s21c1
Sequence:CCGGAGTCTAAAGAGACCAGTATTACTCGAGTAATACTGGTCTCTTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks