EMAIL THIS PAGE TO A FRIEND

EPHA6

EPH receptor A6

129 Gene Product Result for
Synonyms: EHK-2 EHK2 EK12 EPA6 HEK12 PRO57066
UniProtKB ID: Q9UF33
Gene ID:
Mouse(13840) Eph receptor A6
Rat(29202) Eph receptor A6
naked mole-rat(101725725) EPH receptor A6
sheep(101103695) EPH receptor A6
Zebrafish(100005538) eph receptor A6
cow(616165) EPH receptor A6
cow(100336601) EPH receptor A6
Horse(100072575) EPH receptor A6
domestic cat(101087597) EPH receptor A6
dog(607935) EPH receptor A6
chicken(374008) EPH receptor A6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303561 ANTI-EPH RECEPTOR A6 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1409141 Anti-EPHA6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA007397 Anti-EPHA6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA058047 Anti-EPHA6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1304738 ANTI-EPHA6 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4501268 Anti-EPHA6, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB1303560 ANTI-MOUSE EPHA6 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
WH0285220M1 Monoclonal Anti-EPHA6 antibody produced in mouse clone 2H2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300310 Monoclonal Anti-EPHA6 antibody produced in mouse clone 3D5B10, ascites fluid human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0946 Phosphotyrosine EPHA6 / Ephrin Type-A Receptor 6 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173655 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_114973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_114973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_114973 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080448 Rosetta Predictions human pricing
NM_173655 Rosetta Predictions human pricing
XM_114973 Rosetta Predictions human pricing
XM_001057372 Rosetta Predictions rat pricing
XM_221595 Rosetta Predictions rat pricing
NM_007938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314936 predicted 2197
2 SASI_Hs02_00314937 predicted 2287
3 SASI_Hs02_00314938 predicted 2558
4 SASI_Hs02_00314939 predicted 2357
5 SASI_Hs02_00314940 predicted 2580
6 SASI_Hs02_00314941 predicted 2198
7 SASI_Hs02_00314942 predicted 2164
8 SASI_Hs02_00314943 predicted 2321
9 SASI_Hs02_00314944 predicted 2172
10 SASI_Hs02_00314945 predicted 2207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368559 predicted 667
2 SASI_Hs02_00368560 predicted 763
3 SASI_Hs02_00368561 predicted 1032
4 SASI_Hs02_00368562 predicted 834
5 SASI_Hs02_00368563 predicted 1060
6 SASI_Hs02_00368564 predicted 671
7 SASI_Hs02_00368565 predicted 640
8 SASI_Hs02_00368566 predicted 794
9 SASI_Hs02_00368567 predicted 644
10 SASI_Hs02_00368568 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_114973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267039 predicted 2611
2 SASI_Hs01_00267040 predicted 2570
3 SASI_Hs01_00267041 predicted 2559
4 SASI_Hs01_00267042 predicted 2475
5 SASI_Hs01_00267043 predicted 2405
6 SASI_Hs01_00267044 predicted 2611
7 SASI_Hs01_00267045 predicted 2405
8 SASI_Hs01_00267046 predicted 2661
9 SASI_Hs01_00267047 predicted 2417
10 SASI_Hs01_00267048 predicted 2364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286152 predicted 3542
2 SASI_Rn02_00286153 predicted 681
3 SASI_Rn02_00286154 predicted 2372
4 SASI_Rn02_00286155 predicted 1665
5 SASI_Rn02_00286156 predicted 3228
6 SASI_Rn02_00286157 predicted 2601
7 SASI_Rn02_00286158 predicted 2826
8 SASI_Rn02_00286159 predicted 2802
9 SASI_Rn02_00286160 predicted 1869
10 SASI_Rn02_00286161 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380221 predicted 1092
2 SASI_Rn02_00380222 predicted 1505
3 SASI_Rn02_00380223 predicted 1474
4 SASI_Rn02_00380224 predicted 1088
5 SASI_Rn02_00380225 predicted 1353
6 SASI_Rn02_00380226 predicted 1818
7 SASI_Rn02_00380227 predicted 679
8 SASI_Rn02_00380228 predicted 1795
9 SASI_Rn02_00380229 predicted 1663
10 SASI_Rn02_00380230 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312779 predicted 1419
2 SASI_Mm01_00132680 predicted 988
3 SASI_Mm01_00132681 predicted 3567
4 SASI_Mm01_00132683 predicted 2376
5 SASI_Mm01_00132684 predicted 2936
6 SASI_Mm02_00312780 predicted 3731
7 SASI_Mm01_00132685 predicted 3585
8 SASI_Mm01_00132686 predicted 3608
9 SASI_Mm01_00132687 predicted 811
10 SASI_Mm01_00132688 predicted 2601
11 SASI_Mm01_00132682 predicted 2421
12 SASI_Mm01_00132689 predicted 2950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007938
EPHA6 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007938.2-2411s21c1
Sequence:CCGGTCCCTAGCAGTCCACGAATTTCTCGAGAAATTCGTGGACTGCTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007938.2-3547s21c1
Sequence:CCGGACGAATGAGCATCGATGATATCTCGAGATATCATCGATGCTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007938.2-3903s21c1
Sequence:CCGGCATCACTGCAGAACGATAAATCTCGAGATTTATCGTTCTGCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-1122s1c1
Sequence:CCGGCCAGGATTCTACAAAGCATTTCTCGAGAAATGCTTTGTAGAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-919s1c1
Sequence:CCGGGCTTGGCTATGTTTCCTGATACTCGAGTATCAGGAAACATAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-2628s1c1
Sequence:CCGGGCGTCAGGCATGAAGTATCTTCTCGAGAAGATACTTCATGCCTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-3331s1c1
Sequence:CCGGGCAGCATACAAACTTTACGTTCTCGAGAACGTAAAGTTTGTATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-2514s1c1
Sequence:CCGGCGGCCAGTAATGATCGTAGTACTCGAGTACTACGATCATTACTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007938
EPHA6 MISSION shRNA shRNA Plasmid DNA
EPH receptor A6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007938.2-2411s21c1
Sequence:CCGGTCCCTAGCAGTCCACGAATTTCTCGAGAAATTCGTGGACTGCTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007938.2-3547s21c1
Sequence:CCGGACGAATGAGCATCGATGATATCTCGAGATATCATCGATGCTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007938.2-3903s21c1
Sequence:CCGGCATCACTGCAGAACGATAAATCTCGAGATTTATCGTTCTGCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-1122s1c1
Sequence:CCGGCCAGGATTCTACAAAGCATTTCTCGAGAAATGCTTTGTAGAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-919s1c1
Sequence:CCGGGCTTGGCTATGTTTCCTGATACTCGAGTATCAGGAAACATAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-2628s1c1
Sequence:CCGGGCGTCAGGCATGAAGTATCTTCTCGAGAAGATACTTCATGCCTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-3331s1c1
Sequence:CCGGGCAGCATACAAACTTTACGTTCTCGAGAACGTAAAGTTTGTATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-2514s1c1
Sequence:CCGGCGGCCAGTAATGATCGTAGTACTCGAGTACTACGATCATTACTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007938
EPHA6 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007938.2-2411s21c1
Sequence:CCGGTCCCTAGCAGTCCACGAATTTCTCGAGAAATTCGTGGACTGCTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007938.2-3547s21c1
Sequence:CCGGACGAATGAGCATCGATGATATCTCGAGATATCATCGATGCTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007938.2-3903s21c1
Sequence:CCGGCATCACTGCAGAACGATAAATCTCGAGATTTATCGTTCTGCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-1122s1c1
Sequence:CCGGCCAGGATTCTACAAAGCATTTCTCGAGAAATGCTTTGTAGAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-919s1c1
Sequence:CCGGGCTTGGCTATGTTTCCTGATACTCGAGTATCAGGAAACATAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-2628s1c1
Sequence:CCGGGCGTCAGGCATGAAGTATCTTCTCGAGAAGATACTTCATGCCTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-3331s1c1
Sequence:CCGGGCAGCATACAAACTTTACGTTCTCGAGAACGTAAAGTTTGTATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007938.1-2514s1c1
Sequence:CCGGCGGCCAGTAATGATCGTAGTACTCGAGTACTACGATCATTACTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173655
EPHA6 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-1039s1c1
Sequence:CCGGGTAATGATTGTGGTGGAATATCTCGAGATATTCCACCACAATCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-1202s1c1
Sequence:CCGGCTCGGAATATACTGGTCAATACTCGAGTATTGACCAGTATATTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-1224s1c1
Sequence:CCGGCAACTTAGTATGCAAAGTTTCCTCGAGGAAACTTTGCATACTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-425s1c1
Sequence:CCGGCAGCAGAACAAGGACAGATTCCTCGAGGAATCTGTCCTTGTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-868s1c1
Sequence:CCGGCCAAACATCATTCGCCTAGAACTCGAGTTCTAGGCGAATGATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173655.1-1147s1c1
Sequence:CCGGGCATCAGGCATGAAGTATCTTCTCGAGAAGATACTTCATGCCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173655.1-1165s1c1
Sequence:CCGGCTTTCTGATATGGGTTATGTTCTCGAGAACATAACCCATATCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-1201s1c1
Sequence:CCGGGCTCGGAATATACTGGTCAATCTCGAGATTGACCAGTATATTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173655.x-1500s1c1
Sequence:CCGGGTTTGTGAATTGGCTTGACTTCTCGAGAAGTCAAGCCAATTCACAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-424s1c1
Sequence:CCGGGCAGCAGAACAAGGACAGATTCTCGAGAATCTGTCCTTGTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-1301s1c1
Sequence:CCGGCTGACCTCTTCCAAACTCTAACTCGAGTTAGAGTTTGGAAGAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-486s1c1
Sequence:CCGGCGTCATCCTCACTTTATTCTTCTCGAGAAGAATAAAGTGAGGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173655
EPHA6 MISSION shRNA shRNA Plasmid DNA
EPH receptor A6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-1039s1c1
Sequence:CCGGGTAATGATTGTGGTGGAATATCTCGAGATATTCCACCACAATCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-1202s1c1
Sequence:CCGGCTCGGAATATACTGGTCAATACTCGAGTATTGACCAGTATATTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-1224s1c1
Sequence:CCGGCAACTTAGTATGCAAAGTTTCCTCGAGGAAACTTTGCATACTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-425s1c1
Sequence:CCGGCAGCAGAACAAGGACAGATTCCTCGAGGAATCTGTCCTTGTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-868s1c1
Sequence:CCGGCCAAACATCATTCGCCTAGAACTCGAGTTCTAGGCGAATGATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173655.1-1147s1c1
Sequence:CCGGGCATCAGGCATGAAGTATCTTCTCGAGAAGATACTTCATGCCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173655.1-1165s1c1
Sequence:CCGGCTTTCTGATATGGGTTATGTTCTCGAGAACATAACCCATATCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-1201s1c1
Sequence:CCGGGCTCGGAATATACTGGTCAATCTCGAGATTGACCAGTATATTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173655.x-1500s1c1
Sequence:CCGGGTTTGTGAATTGGCTTGACTTCTCGAGAAGTCAAGCCAATTCACAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-424s1c1
Sequence:CCGGGCAGCAGAACAAGGACAGATTCTCGAGAATCTGTCCTTGTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-1301s1c1
Sequence:CCGGCTGACCTCTTCCAAACTCTAACTCGAGTTAGAGTTTGGAAGAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-486s1c1
Sequence:CCGGCGTCATCCTCACTTTATTCTTCTCGAGAAGAATAAAGTGAGGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173655
EPHA6 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-1039s1c1
Sequence:CCGGGTAATGATTGTGGTGGAATATCTCGAGATATTCCACCACAATCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-1202s1c1
Sequence:CCGGCTCGGAATATACTGGTCAATACTCGAGTATTGACCAGTATATTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-1224s1c1
Sequence:CCGGCAACTTAGTATGCAAAGTTTCCTCGAGGAAACTTTGCATACTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-425s1c1
Sequence:CCGGCAGCAGAACAAGGACAGATTCCTCGAGGAATCTGTCCTTGTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.1-868s1c1
Sequence:CCGGCCAAACATCATTCGCCTAGAACTCGAGTTCTAGGCGAATGATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173655.1-1147s1c1
Sequence:CCGGGCATCAGGCATGAAGTATCTTCTCGAGAAGATACTTCATGCCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173655.1-1165s1c1
Sequence:CCGGCTTTCTGATATGGGTTATGTTCTCGAGAACATAACCCATATCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-1201s1c1
Sequence:CCGGGCTCGGAATATACTGGTCAATCTCGAGATTGACCAGTATATTCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173655.x-1500s1c1
Sequence:CCGGGTTTGTGAATTGGCTTGACTTCTCGAGAAGTCAAGCCAATTCACAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-424s1c1
Sequence:CCGGGCAGCAGAACAAGGACAGATTCTCGAGAATCTGTCCTTGTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-1301s1c1
Sequence:CCGGCTGACCTCTTCCAAACTCTAACTCGAGTTAGAGTTTGGAAGAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173655.x-486s1c1
Sequence:CCGGCGTCATCCTCACTTTATTCTTCTCGAGAAGAATAAAGTGAGGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_114973
EPHA6 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A6
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000021415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114973.3-1602s1c1
Sequence:CCGGCCCAAGCCATTCACAGCTATTCTCGAGAATAGCTGTGAATGGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114973.3-818s1c1
Sequence:CCGGCCTCAAACTCAACACTGAAATCTCGAGATTTCAGTGTTGAGTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114973.3-495s1c1
Sequence:CCGGGCCATCACTGAAATGGATGAACTCGAGTTCATCCATTTCAGTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_114973.3-1726s1c1
Sequence:CCGGGCAGGTGCTATGCAGTCATATCTCGAGATATGACTGCATAGCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_114973
EPHA6 MISSION shRNA shRNA Plasmid DNA
EPH receptor A6
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000021415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114973.3-1602s1c1
Sequence:CCGGCCCAAGCCATTCACAGCTATTCTCGAGAATAGCTGTGAATGGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114973.3-818s1c1
Sequence:CCGGCCTCAAACTCAACACTGAAATCTCGAGATTTCAGTGTTGAGTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114973.3-495s1c1
Sequence:CCGGGCCATCACTGAAATGGATGAACTCGAGTTCATCCATTTCAGTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_114973.3-1726s1c1
Sequence:CCGGGCAGGTGCTATGCAGTCATATCTCGAGATATGACTGCATAGCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_114973
EPHA6 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A6
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000021415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114973.3-1602s1c1
Sequence:CCGGCCCAAGCCATTCACAGCTATTCTCGAGAATAGCTGTGAATGGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114973.3-818s1c1
Sequence:CCGGCCTCAAACTCAACACTGAAATCTCGAGATTTCAGTGTTGAGTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114973.3-495s1c1
Sequence:CCGGGCCATCACTGAAATGGATGAACTCGAGTTCATCCATTTCAGTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_114973.3-1726s1c1
Sequence:CCGGGCAGGTGCTATGCAGTCATATCTCGAGATATGACTGCATAGCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks