EMAIL THIS PAGE TO A FRIEND

EPHA7

EPH receptor A7

221 Gene Product Result for
Synonyms: EHK3 HEK11
Gene ID:
Human(2045) Summary: This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
Mouse(13841) Eph receptor A7
Rat(171287) Eph receptor A7
Zebrafish(562195) eph receptor A7
Horse(100065867) EPH receptor A7
cow(538797) EPH receptor A7
dog(474997) EPH receptor A7
chicken(395967) EPH receptor A7
sheep(101107288) EPH receptor A7
Domestic Rabbit(100344577) EPH receptor A7
naked mole-rat(101716555) EPH receptor A7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0947 Phosphotyrosine EPHA7 / Ephrin Type-A Receptor 7 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004440 Rosetta Predictions human pricing
NM_134331 Rosetta Predictions rat pricing
NM_001122889 Rosetta Predictions mouse pricing
NM_010141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154990 predicted 701
2 SASI_Hs01_00154992 predicted 2806
3 SASI_Hs01_00154993 predicted 2315
4 SASI_Hs01_00154994 predicted 1639
5 SASI_Hs01_00154995 predicted 3092
6 SASI_Hs01_00154996 predicted 3053
7 SASI_Hs01_00154997 predicted 2713
8 SASI_Hs01_00154998 predicted 3252
9 SASI_Hs02_00337615 predicted 418
10 SASI_Hs02_00337616 predicted 817
11 SASI_Hs01_00154989 predicted 2033
12 SASI_Hs01_00154991 predicted 2060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112981 predicted 1963
2 SASI_Rn01_00112983 predicted 1982
3 SASI_Rn01_00112984 predicted 2322
4 SASI_Rn01_00112985 predicted 2656
5 SASI_Rn01_00112986 predicted 2617
6 SASI_Rn01_00112987 predicted 766
7 SASI_Rn01_00112989 predicted 1281
8 SASI_Rn02_00267877 predicted 736
9 SASI_Rn02_00267878 predicted 1567
10 SASI_Rn02_00267879 predicted 2813
11 SASI_Rn01_00112982 predicted 377
12 SASI_Rn01_00112988 predicted 1073
13 SASI_Rn01_00112990 predicted 2220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309529 predicted 1146
2 SASI_Mm02_00309530 predicted 492
3 SASI_Mm02_00309531 predicted 1500
4 SASI_Mm02_00309532 predicted 1166
5 SASI_Mm02_00309533 predicted 586
6 SASI_Mm02_00309534 predicted 1484
7 SASI_Mm02_00309535 predicted 1106
8 SASI_Mm02_00309536 predicted 1083
9 SASI_Mm02_00309537 predicted 427
10 SASI_Mm02_00309538 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317879 predicted 1153
2 SASI_Mm01_00109993 predicted 492
3 SASI_Mm02_00317880 predicted 1500
4 SASI_Mm01_00109995 predicted 1165
5 SASI_Mm01_00109997 predicted 588
6 SASI_Mm01_00109998 predicted 1484
7 SASI_Mm02_00317881 predicted 1111
8 SASI_Mm01_00109999 predicted 1087
9 SASI_Mm01_00110000 predicted 425
10 SASI_Mm02_00317882 predicted 340
11 SASI_Mm01_00109992 predicted 2058
12 SASI_Mm01_00109994 predicted 2084
13 SASI_Mm01_00109996 predicted 2772
14 SASI_Mm01_00110001 predicted 2477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004440
VALIDATED
EPHA7 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A7
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-4694s1c1
Sequence:CCGGCGGTCATAATTGGTCTTGTTTCTCGAGAAACAAGACCAATTATGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004440.2-3052s1c1
Sequence:CCGGGCTGGCTACAATTCCCTTGAACTCGAGTTCAAGGGAATTGTAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-829s1c1
Sequence:CCGGTGGTCCATTATTGAGAACTTACTCGAGTAAGTTCTCAATAATGGACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004440.2-1859s1c1
Sequence:CCGGCCAGTGAACAGAATCCTGTTACTCGAGTAACAGGATTCTGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-2283s1c1
Sequence:CCGGCCACCCAAATGTTGTCCATTTCTCGAGAAATGGACAACATTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-1701s1c1
Sequence:CCGGGTCTACTTCAGCCTCCATTAACTCGAGTTAATGGAGGCTGAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-2325s1c1
Sequence:CCGGGAAACCAGTCATGATAGTAATCTCGAGATTACTATCATGACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004440.2-3265s1c1
Sequence:CCGGCTTCAGTATATGCATAGAATGCTCGAGCATTCTATGCATATACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-1296s1c1
Sequence:CCGGCGATGTGACCTACAGAATATTCTCGAGAATATTCTGTAGGTCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004440.2-2927s1c1
Sequence:CCGGGAACTTGTAGTAGGCCAATAACTCGAGTTATTGGCCTACTACAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004440.2-310s1c1
Sequence:CCGGGTACTACTGCTGGATTCTAAACTCGAGTTTAGAATCCAGCAGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004440.3-3361s21c1
Sequence:GTACCGGAGATTTAAGAAGCACCTATAGCTCGAGCTATAGGTGCTTCTTAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004440.3-2353s21c1
Sequence:CCGGGAAACCAGTCATGATAGTAATCTCGAGATTACTATCATGACTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004440.3-1729s21c1
Sequence:CCGGGTCTACTTCAGCCTCCATTAACTCGAGTTAATGGAGGCTGAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004440.3-1324s21c1
Sequence:CCGGCGATGTGACCTACAGAATATTCTCGAGAATATTCTGTAGGTCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004440.3-857s21c1
Sequence:CCGGTGGTCCATTATTGAGAACTTACTCGAGTAAGTTCTCAATAATGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004440
VALIDATED
EPHA7 MISSION shRNA shRNA Plasmid DNA
EPH receptor A7
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-4694s1c1
Sequence:CCGGCGGTCATAATTGGTCTTGTTTCTCGAGAAACAAGACCAATTATGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004440.2-3052s1c1
Sequence:CCGGGCTGGCTACAATTCCCTTGAACTCGAGTTCAAGGGAATTGTAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-829s1c1
Sequence:CCGGTGGTCCATTATTGAGAACTTACTCGAGTAAGTTCTCAATAATGGACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004440.2-1859s1c1
Sequence:CCGGCCAGTGAACAGAATCCTGTTACTCGAGTAACAGGATTCTGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-2283s1c1
Sequence:CCGGCCACCCAAATGTTGTCCATTTCTCGAGAAATGGACAACATTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-1701s1c1
Sequence:CCGGGTCTACTTCAGCCTCCATTAACTCGAGTTAATGGAGGCTGAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-2325s1c1
Sequence:CCGGGAAACCAGTCATGATAGTAATCTCGAGATTACTATCATGACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004440.2-3265s1c1
Sequence:CCGGCTTCAGTATATGCATAGAATGCTCGAGCATTCTATGCATATACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-1296s1c1
Sequence:CCGGCGATGTGACCTACAGAATATTCTCGAGAATATTCTGTAGGTCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004440.2-2927s1c1
Sequence:CCGGGAACTTGTAGTAGGCCAATAACTCGAGTTATTGGCCTACTACAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004440.2-310s1c1
Sequence:CCGGGTACTACTGCTGGATTCTAAACTCGAGTTTAGAATCCAGCAGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004440.3-3361s21c1
Sequence:GTACCGGAGATTTAAGAAGCACCTATAGCTCGAGCTATAGGTGCTTCTTAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004440.3-2353s21c1
Sequence:CCGGGAAACCAGTCATGATAGTAATCTCGAGATTACTATCATGACTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004440.3-1729s21c1
Sequence:CCGGGTCTACTTCAGCCTCCATTAACTCGAGTTAATGGAGGCTGAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004440.3-1324s21c1
Sequence:CCGGCGATGTGACCTACAGAATATTCTCGAGAATATTCTGTAGGTCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004440.3-857s21c1
Sequence:CCGGTGGTCCATTATTGAGAACTTACTCGAGTAAGTTCTCAATAATGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004440
VALIDATED
EPHA7 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A7
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-4694s1c1
Sequence:CCGGCGGTCATAATTGGTCTTGTTTCTCGAGAAACAAGACCAATTATGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004440.2-3052s1c1
Sequence:CCGGGCTGGCTACAATTCCCTTGAACTCGAGTTCAAGGGAATTGTAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-829s1c1
Sequence:CCGGTGGTCCATTATTGAGAACTTACTCGAGTAAGTTCTCAATAATGGACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004440.2-1859s1c1
Sequence:CCGGCCAGTGAACAGAATCCTGTTACTCGAGTAACAGGATTCTGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-2283s1c1
Sequence:CCGGCCACCCAAATGTTGTCCATTTCTCGAGAAATGGACAACATTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-1701s1c1
Sequence:CCGGGTCTACTTCAGCCTCCATTAACTCGAGTTAATGGAGGCTGAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-2325s1c1
Sequence:CCGGGAAACCAGTCATGATAGTAATCTCGAGATTACTATCATGACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004440.2-3265s1c1
Sequence:CCGGCTTCAGTATATGCATAGAATGCTCGAGCATTCTATGCATATACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004440.2-1296s1c1
Sequence:CCGGCGATGTGACCTACAGAATATTCTCGAGAATATTCTGTAGGTCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004440.2-2927s1c1
Sequence:CCGGGAACTTGTAGTAGGCCAATAACTCGAGTTATTGGCCTACTACAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004440.2-310s1c1
Sequence:CCGGGTACTACTGCTGGATTCTAAACTCGAGTTTAGAATCCAGCAGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004440.3-3361s21c1
Sequence:GTACCGGAGATTTAAGAAGCACCTATAGCTCGAGCTATAGGTGCTTCTTAAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004440.3-2353s21c1
Sequence:CCGGGAAACCAGTCATGATAGTAATCTCGAGATTACTATCATGACTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004440.3-1729s21c1
Sequence:CCGGGTCTACTTCAGCCTCCATTAACTCGAGTTAATGGAGGCTGAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004440.3-1324s21c1
Sequence:CCGGCGATGTGACCTACAGAATATTCTCGAGAATATTCTGTAGGTCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004440.3-857s21c1
Sequence:CCGGTGGTCCATTATTGAGAACTTACTCGAGTAAGTTCTCAATAATGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010141
VALIDATED
EPHA7 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010141.2-3184s1c1
Sequence:CCGGGCGGGCACAAATGTTGCATTTCTCGAGAAATGCAACATTTGTGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-2775s1c1
Sequence:CCGGCGATAGAAGAAGGTTATCGTTCTCGAGAACGATAACCTTCTTCTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-633s1c1
Sequence:CCGGCCGGCAGGAATATACGAGAAACTCGAGTTTCTCGTATATTCCTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-1378s1c1
Sequence:CCGGCGGAAGTAACATTGGATACATCTCGAGATGTATCCAATGTTACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-2302s1c1
Sequence:CCGGCCACCCAAATGTCGTCCATTTCTCGAGAAATGGACGACATTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-592s21c1
Sequence:CCGGCTTGCAAGGAAACGTTTAATTCTCGAGAATTAAACGTTTCCTTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-3026s21c1
Sequence:CCGGAGAATGGTTGCAAGCTATTAACTCGAGTTAATAGCTTGCAACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010141.3-3387s21c1
Sequence:CCGGCCTAAGTGCCACCAGAATATACTCGAGTATATTCTGGTGGCACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-2782s21c1
Sequence:CCGGCGATAGAAGAAGGTTATCGTTCTCGAGAACGATAACCTTCTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-325s21c1
Sequence:CCGGCTGCGAAGGAAGTACTATTACCTCGAGGTAATAGTACTTCCTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010141
VALIDATED
EPHA7 MISSION shRNA shRNA Plasmid DNA
EPH receptor A7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010141.2-3184s1c1
Sequence:CCGGGCGGGCACAAATGTTGCATTTCTCGAGAAATGCAACATTTGTGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-2775s1c1
Sequence:CCGGCGATAGAAGAAGGTTATCGTTCTCGAGAACGATAACCTTCTTCTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-633s1c1
Sequence:CCGGCCGGCAGGAATATACGAGAAACTCGAGTTTCTCGTATATTCCTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-1378s1c1
Sequence:CCGGCGGAAGTAACATTGGATACATCTCGAGATGTATCCAATGTTACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-2302s1c1
Sequence:CCGGCCACCCAAATGTCGTCCATTTCTCGAGAAATGGACGACATTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-592s21c1
Sequence:CCGGCTTGCAAGGAAACGTTTAATTCTCGAGAATTAAACGTTTCCTTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-3026s21c1
Sequence:CCGGAGAATGGTTGCAAGCTATTAACTCGAGTTAATAGCTTGCAACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010141.3-3387s21c1
Sequence:CCGGCCTAAGTGCCACCAGAATATACTCGAGTATATTCTGGTGGCACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-2782s21c1
Sequence:CCGGCGATAGAAGAAGGTTATCGTTCTCGAGAACGATAACCTTCTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-325s21c1
Sequence:CCGGCTGCGAAGGAAGTACTATTACCTCGAGGTAATAGTACTTCCTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010141
VALIDATED
EPHA7 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010141.2-3184s1c1
Sequence:CCGGGCGGGCACAAATGTTGCATTTCTCGAGAAATGCAACATTTGTGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-2775s1c1
Sequence:CCGGCGATAGAAGAAGGTTATCGTTCTCGAGAACGATAACCTTCTTCTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-633s1c1
Sequence:CCGGCCGGCAGGAATATACGAGAAACTCGAGTTTCTCGTATATTCCTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-1378s1c1
Sequence:CCGGCGGAAGTAACATTGGATACATCTCGAGATGTATCCAATGTTACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010141.2-2302s1c1
Sequence:CCGGCCACCCAAATGTCGTCCATTTCTCGAGAAATGGACGACATTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-592s21c1
Sequence:CCGGCTTGCAAGGAAACGTTTAATTCTCGAGAATTAAACGTTTCCTTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-3026s21c1
Sequence:CCGGAGAATGGTTGCAAGCTATTAACTCGAGTTAATAGCTTGCAACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010141.3-3387s21c1
Sequence:CCGGCCTAAGTGCCACCAGAATATACTCGAGTATATTCTGGTGGCACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-2782s21c1
Sequence:CCGGCGATAGAAGAAGGTTATCGTTCTCGAGAACGATAACCTTCTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010141.3-325s21c1
Sequence:CCGGCTGCGAAGGAAGTACTATTACCTCGAGGTAATAGTACTTCCTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks