EMAIL THIS PAGE TO A FRIEND

EPHA8

EPH receptor A8

148 Gene Product Result for
Synonyms: EEK EK3 HEK3
UniProtKB ID: P29322, Q6IN80, Q8IUX6, Q9NUA9, Q9P269
Gene ID:
Human(2046) Summary: This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
Mouse(13842) Eph receptor A8
Rat(60589) Eph receptor A8
naked mole-rat(101703141) EPH receptor A8
sheep(101122177) EPH receptor A8
Domestic Rabbit(100338073) EPH receptor A8
Zebrafish(570677) eph receptor A8
dog(487383) EPH receptor A8
cow(517368) EPH receptor A8
Horse(100071673) EPH receptor A8
domestic cat(101095669) EPH receptor A8
chicken(428198) EPH receptor A8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0948 Phosphotyrosine EPHA8 / Ephrin Type-A Receptor 8 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU050201 MISSION® esiRNA esiRNA targeting mouse Epha8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006943 Rosetta Predictions human pricing
NM_020526 Rosetta Predictions human pricing
XM_001069777 Rosetta Predictions rat pricing
XM_342952 Rosetta Predictions rat pricing
NM_007939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149878 predicted 612
2 SASI_Hs01_00149879 predicted 1131
3 SASI_Hs02_00305155 predicted 1193
4 SASI_Hs02_00305156 predicted 943
5 SASI_Hs01_00149880 predicted 1133
6 SASI_Hs02_00305157 predicted 527
7 SASI_Hs01_00149884 predicted 1134
8 SASI_Hs01_00149885 predicted 1109
9 SASI_Hs01_00149886 predicted 828
10 SASI_Hs01_00149887 predicted 702
11 SASI_Hs01_00149881 predicted 950
12 SASI_Hs01_00149882 predicted 1050
13 SASI_Hs01_00149883 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189808 predicted 612
2 SASI_Hs01_00189809 predicted 1128
3 SASI_Hs02_00353571 predicted 1190
4 SASI_Hs02_00353572 predicted 944
5 SASI_Hs01_00189810 predicted 1135
6 SASI_Hs02_00353573 predicted 529
7 SASI_Hs01_00189814 predicted 1135
8 SASI_Hs01_00189815 predicted 1111
9 SASI_Hs01_00189816 predicted 821
10 SASI_Hs01_00189817 predicted 696
11 SASI_Hs01_00189811 predicted 954
12 SASI_Hs01_00189812 predicted 1048
13 SASI_Hs01_00189813 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329253 predicted 273
2 SASI_Rn02_00329254 predicted 1318
3 SASI_Rn02_00329255 predicted 1154
4 SASI_Rn02_00329256 predicted 204
5 SASI_Rn02_00329257 predicted 1124
6 SASI_Rn02_00329258 predicted 1369
7 SASI_Rn02_00329259 predicted 1983
8 SASI_Rn02_00329260 predicted 2039
9 SASI_Rn02_00329261 predicted 1968
10 SASI_Rn02_00329262 predicted 2432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395111 predicted 402
2 SASI_Rn02_00395112 predicted 1316
3 SASI_Rn02_00395113 predicted 3341
4 SASI_Rn02_00395114 predicted 1633
5 SASI_Rn02_00395115 predicted 1303
6 SASI_Rn02_00395116 predicted 1428
7 SASI_Rn02_00395117 predicted 3285
8 SASI_Rn02_00395118 predicted 276
9 SASI_Rn02_00395119 predicted 1127
10 SASI_Rn02_00395120 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116770 predicted 1304
2 SASI_Mm02_00312781 predicted 1516
3 SASI_Mm01_00116771 predicted 1467
4 SASI_Mm01_00116772 predicted 1795
5 SASI_Mm01_00116773 predicted 2129
6 SASI_Mm01_00116774 predicted 982
7 SASI_Mm02_00312782 predicted 2189
8 SASI_Mm01_00116775 predicted 352
9 SASI_Mm02_00312783 predicted 1503
10 SASI_Mm01_00116777 predicted 1271
11 SASI_Mm01_00116776 predicted 2204
12 SASI_Mm01_00116778 predicted 1533
13 SASI_Mm01_00116779 predicted 1821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020526
VALIDATED
EPHA8 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A8
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1353s21c1
Sequence:CCGGTTCTGGATCGAGGCCGTCAATCTCGAGATTGACGGCCTCGATCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020526.3-3544s21c1
Sequence:CCGGAGCATGGACGTGTGCATGTTACTCGAGTAACATGCACACGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1862s21c1
Sequence:CCGGGGAGAAGATGCACTATCAGAACTCGAGTTCTGATAGTGCATCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-334s21c1
Sequence:CCGGACCAGGTTTGCAACGTCATGACTCGAGTCATGACGTTGCAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-415s21c1
Sequence:GTACCGGTCTATGCTGAGATCAAGTTTACTCGAGTAAACTTGATCTCAGCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020526.3-3566s21c1
Sequence:CCGGGAGCGTGTGCTTATCCGTTAACTCGAGTTAACGGATAAGCACACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1539s21c1
Sequence:CCGGGAGTATGAGATCAAGTACTACCTCGAGGTAGTACTTGATCTCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1195s21c1
Sequence:CCGGGCAGTGACATCACCTACAATGCTCGAGCATTGTAGGTGATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-709s21c1
Sequence:CCGGTCTCTCTCCGCATCTACTATACTCGAGTATAGTAGATGCGGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-2192s21c1
Sequence:CCGGGCAATTCGACCATCCCAACATCTCGAGATGTTGGGATGGTCGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020526.3-3545s1c1
Sequence:CCGGGCATGGACGTGTGCATGTTATCTCGAGATAACATGCACACGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020526.3-3566s1c1
Sequence:CCGGGAGCGTGTGCTTATCCGTTAACTCGAGTTAACGGATAAGCACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.3-1194s1c1
Sequence:CCGGCGCAGTGACATCACCTACAATCTCGAGATTGTAGGTGATGTCACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.3-1136s1c1
Sequence:CCGGCAGTGTGAATGGGACATCAGTCTCGAGACTGATGTCCCATTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020526.3-1539s1c1
Sequence:CCGGGAGTATGAGATCAAGTACTACCTCGAGGTAGTACTTGATCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020526.x-4708s1c1
Sequence:CCGGCGAGCTGTTCTTCCTTCCTATCTCGAGATAGGAAGGAAGAACAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-1844s1c1
Sequence:CCGGGACGAGGAGAAGATGCACTATCTCGAGATAGTGCATCTTCTCCTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-201s1c1
Sequence:CCGGGCGAAGTGAATTTGCTGGACACTCGAGTGTCCAGCAAATTCACTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-2771s1c1
Sequence:CCGGCAGATTGTCAGTGTCCTCGATCTCGAGATCGAGGACACTGACAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-712s1c1
Sequence:CCGGCTATAAGAAGTGCCCTGCCATCTCGAGATGGCAGGGCACTTCTTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020526
VALIDATED
EPHA8 MISSION shRNA shRNA Plasmid DNA
EPH receptor A8
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1353s21c1
Sequence:CCGGTTCTGGATCGAGGCCGTCAATCTCGAGATTGACGGCCTCGATCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020526.3-3544s21c1
Sequence:CCGGAGCATGGACGTGTGCATGTTACTCGAGTAACATGCACACGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1862s21c1
Sequence:CCGGGGAGAAGATGCACTATCAGAACTCGAGTTCTGATAGTGCATCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-334s21c1
Sequence:CCGGACCAGGTTTGCAACGTCATGACTCGAGTCATGACGTTGCAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-415s21c1
Sequence:GTACCGGTCTATGCTGAGATCAAGTTTACTCGAGTAAACTTGATCTCAGCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020526.3-3566s21c1
Sequence:CCGGGAGCGTGTGCTTATCCGTTAACTCGAGTTAACGGATAAGCACACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1539s21c1
Sequence:CCGGGAGTATGAGATCAAGTACTACCTCGAGGTAGTACTTGATCTCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1195s21c1
Sequence:CCGGGCAGTGACATCACCTACAATGCTCGAGCATTGTAGGTGATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-709s21c1
Sequence:CCGGTCTCTCTCCGCATCTACTATACTCGAGTATAGTAGATGCGGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-2192s21c1
Sequence:CCGGGCAATTCGACCATCCCAACATCTCGAGATGTTGGGATGGTCGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020526.3-3545s1c1
Sequence:CCGGGCATGGACGTGTGCATGTTATCTCGAGATAACATGCACACGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020526.3-3566s1c1
Sequence:CCGGGAGCGTGTGCTTATCCGTTAACTCGAGTTAACGGATAAGCACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.3-1194s1c1
Sequence:CCGGCGCAGTGACATCACCTACAATCTCGAGATTGTAGGTGATGTCACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.3-1136s1c1
Sequence:CCGGCAGTGTGAATGGGACATCAGTCTCGAGACTGATGTCCCATTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020526.3-1539s1c1
Sequence:CCGGGAGTATGAGATCAAGTACTACCTCGAGGTAGTACTTGATCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020526.x-4708s1c1
Sequence:CCGGCGAGCTGTTCTTCCTTCCTATCTCGAGATAGGAAGGAAGAACAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-1844s1c1
Sequence:CCGGGACGAGGAGAAGATGCACTATCTCGAGATAGTGCATCTTCTCCTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-201s1c1
Sequence:CCGGGCGAAGTGAATTTGCTGGACACTCGAGTGTCCAGCAAATTCACTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-2771s1c1
Sequence:CCGGCAGATTGTCAGTGTCCTCGATCTCGAGATCGAGGACACTGACAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-712s1c1
Sequence:CCGGCTATAAGAAGTGCCCTGCCATCTCGAGATGGCAGGGCACTTCTTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020526
VALIDATED
EPHA8 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A8
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1353s21c1
Sequence:CCGGTTCTGGATCGAGGCCGTCAATCTCGAGATTGACGGCCTCGATCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020526.3-3544s21c1
Sequence:CCGGAGCATGGACGTGTGCATGTTACTCGAGTAACATGCACACGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1862s21c1
Sequence:CCGGGGAGAAGATGCACTATCAGAACTCGAGTTCTGATAGTGCATCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-334s21c1
Sequence:CCGGACCAGGTTTGCAACGTCATGACTCGAGTCATGACGTTGCAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-415s21c1
Sequence:GTACCGGTCTATGCTGAGATCAAGTTTACTCGAGTAAACTTGATCTCAGCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020526.3-3566s21c1
Sequence:CCGGGAGCGTGTGCTTATCCGTTAACTCGAGTTAACGGATAAGCACACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1539s21c1
Sequence:CCGGGAGTATGAGATCAAGTACTACCTCGAGGTAGTACTTGATCTCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-1195s21c1
Sequence:CCGGGCAGTGACATCACCTACAATGCTCGAGCATTGTAGGTGATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-709s21c1
Sequence:CCGGTCTCTCTCCGCATCTACTATACTCGAGTATAGTAGATGCGGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020526.3-2192s21c1
Sequence:CCGGGCAATTCGACCATCCCAACATCTCGAGATGTTGGGATGGTCGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020526.3-3545s1c1
Sequence:CCGGGCATGGACGTGTGCATGTTATCTCGAGATAACATGCACACGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020526.3-3566s1c1
Sequence:CCGGGAGCGTGTGCTTATCCGTTAACTCGAGTTAACGGATAAGCACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.3-1194s1c1
Sequence:CCGGCGCAGTGACATCACCTACAATCTCGAGATTGTAGGTGATGTCACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.3-1136s1c1
Sequence:CCGGCAGTGTGAATGGGACATCAGTCTCGAGACTGATGTCCCATTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020526.3-1539s1c1
Sequence:CCGGGAGTATGAGATCAAGTACTACCTCGAGGTAGTACTTGATCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020526.x-4708s1c1
Sequence:CCGGCGAGCTGTTCTTCCTTCCTATCTCGAGATAGGAAGGAAGAACAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-1844s1c1
Sequence:CCGGGACGAGGAGAAGATGCACTATCTCGAGATAGTGCATCTTCTCCTCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-201s1c1
Sequence:CCGGGCGAAGTGAATTTGCTGGACACTCGAGTGTCCAGCAAATTCACTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-2771s1c1
Sequence:CCGGCAGATTGTCAGTGTCCTCGATCTCGAGATCGAGGACACTGACAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020526.x-712s1c1
Sequence:CCGGCTATAAGAAGTGCCCTGCCATCTCGAGATGGCAGGGCACTTCTTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007939
EPHA8 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007939.2-3090s21c1
Sequence:CCGGGGCCACTTGGCACTGGTTATACTCGAGTATAACCAGTGCCAAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007939.2-353s21c1
Sequence:CCGGGTGTCTACGCCGAGATCAAATCTCGAGATTTGATCTCGGCGTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007939.2-1067s21c1
Sequence:CCGGACCTGATCTCCAGCGTAAATGCTCGAGCATTTACGCTGGAGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007939.2-2120s21c1
Sequence:CCGGCAGCCATCATGGGCCAATTTGCTCGAGCAAATTGGCCCATGATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-1527s1c1
Sequence:CCGGGCAAAGCTACTCTACCCTCAACTCGAGTTGAGGGTAGAGTAGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-1944s1c1
Sequence:CCGGCCGGAGCTTTACCCGAGAGATCTCGAGATCTCTCGGGTAAAGCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-174s1c1
Sequence:CCGGCTTGTTGGATACATCAACCATCTCGAGATGGTTGATGTATCCAACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-663s1c1
Sequence:CCGGACTCCGAATCTACTACAAGAACTCGAGTTCTTGTAGTAGATTCGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-1746s1c1
Sequence:CCGGCCTCTTGCTTCTCATCTGCAACTCGAGTTGCAGATGAGAAGCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007939
EPHA8 MISSION shRNA shRNA Plasmid DNA
EPH receptor A8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007939.2-3090s21c1
Sequence:CCGGGGCCACTTGGCACTGGTTATACTCGAGTATAACCAGTGCCAAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007939.2-353s21c1
Sequence:CCGGGTGTCTACGCCGAGATCAAATCTCGAGATTTGATCTCGGCGTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007939.2-1067s21c1
Sequence:CCGGACCTGATCTCCAGCGTAAATGCTCGAGCATTTACGCTGGAGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007939.2-2120s21c1
Sequence:CCGGCAGCCATCATGGGCCAATTTGCTCGAGCAAATTGGCCCATGATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-1527s1c1
Sequence:CCGGGCAAAGCTACTCTACCCTCAACTCGAGTTGAGGGTAGAGTAGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-1944s1c1
Sequence:CCGGCCGGAGCTTTACCCGAGAGATCTCGAGATCTCTCGGGTAAAGCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-174s1c1
Sequence:CCGGCTTGTTGGATACATCAACCATCTCGAGATGGTTGATGTATCCAACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-663s1c1
Sequence:CCGGACTCCGAATCTACTACAAGAACTCGAGTTCTTGTAGTAGATTCGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-1746s1c1
Sequence:CCGGCCTCTTGCTTCTCATCTGCAACTCGAGTTGCAGATGAGAAGCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007939
EPHA8 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007939.2-3090s21c1
Sequence:CCGGGGCCACTTGGCACTGGTTATACTCGAGTATAACCAGTGCCAAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007939.2-353s21c1
Sequence:CCGGGTGTCTACGCCGAGATCAAATCTCGAGATTTGATCTCGGCGTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007939.2-1067s21c1
Sequence:CCGGACCTGATCTCCAGCGTAAATGCTCGAGCATTTACGCTGGAGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007939.2-2120s21c1
Sequence:CCGGCAGCCATCATGGGCCAATTTGCTCGAGCAAATTGGCCCATGATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-1527s1c1
Sequence:CCGGGCAAAGCTACTCTACCCTCAACTCGAGTTGAGGGTAGAGTAGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-1944s1c1
Sequence:CCGGCCGGAGCTTTACCCGAGAGATCTCGAGATCTCTCGGGTAAAGCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-174s1c1
Sequence:CCGGCTTGTTGGATACATCAACCATCTCGAGATGGTTGATGTATCCAACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-663s1c1
Sequence:CCGGACTCCGAATCTACTACAAGAACTCGAGTTCTTGTAGTAGATTCGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007939.1-1746s1c1
Sequence:CCGGCCTCTTGCTTCTCATCTGCAACTCGAGTTGCAGATGAGAAGCAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks