EMAIL THIS PAGE TO A FRIEND

EPHB1

EPH receptor B1

184 Gene Product Result for
Synonyms: ELK EPHT2 Hek6 NET
UniProtKB ID: P54762, A8K593, O43569, O95142, O95143, Q0VG87
Gene ID:
Human(2047) Summary: Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]
Mouse(270190) Eph receptor B1
Rat(24338) Eph receptor B1
Zebrafish(100333537) EPH receptor B1
cow(534731) EPH receptor B1
Horse(100053254) EPH receptor B1
domestic cat(101086086) EPH receptor B1
dog(485671) EPH receptor B1
chicken(396177) EPH receptor B1
sheep(101114662) EPH receptor B1
naked mole-rat(101726285) EPH receptor B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E5892 Anti-EphB1 (ELK Receptor)-EXT antibody produced in sheep purified immunoglobulin, buffered aqueous solution human
immunoprecipitation, western blot pricing
E7025 Anti-EphB1 antibody produced in goat affinity isolated antibody, lyophilized powder rat
ELISA, western blot pricing
SAB1405763 Anti-EPHB1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4500732 Anti-EPHB1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500775 Anti-EPHB1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4500776 Anti-EPHB1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
HPA067740 Anti-EPHB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, immunohistochemistry pricing
SAB4504172 Anti-phospho-EPHB1/2 (pTyr594/604) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB1402765 Monoclonal Anti-EPHB1 antibody produced in mouse clone 4G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300309 Monoclonal Anti-EPHB1 antibody produced in mouse clone 5F10A4, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0949 Phosphotyrosine EPHB1 / Ephrin Type-B Receptor 1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004441 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133831 MISSION® esiRNA esiRNA human EPHB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004441 Rosetta Predictions human pricing
NM_001104528 Rosetta Predictions rat pricing
XM_217250 Rosetta Predictions rat pricing
NM_173447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204241 predicted 2200
2 SASI_Hs01_00204242 predicted 1911
3 SASI_Hs01_00204243 predicted 3118
4 SASI_Hs01_00204244 predicted 2126
5 SASI_Hs01_00204245 predicted 2947
6 SASI_Hs01_00204247 predicted 2329
7 SASI_Hs01_00204248 predicted 3134
8 SASI_Hs01_00204249 predicted 1617
9 SASI_Hs01_00204250 predicted 475
10 SASI_Hs02_00337617 predicted 2456
11 SASI_Hs01_00204246 predicted 3061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211646 predicted 2366
2 SASI_Rn02_00211647 predicted 1690
3 SASI_Rn02_00211648 predicted 2171
4 SASI_Rn02_00211649 predicted 1674
5 SASI_Rn02_00211650 predicted 1432
6 SASI_Rn02_00211651 predicted 1660
7 SASI_Rn02_00211652 predicted 1176
8 SASI_Rn02_00211653 predicted 1024
9 SASI_Rn02_00211654 predicted 577
10 SASI_Rn02_00211655 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00132128 predicted 1774
2 SASI_Rn01_00132129 predicted 898
3 SASI_Rn01_00132130 predicted 567
4 SASI_Rn01_00132131 predicted 680
5 SASI_Rn01_00132132 predicted 1769
6 SASI_Rn01_00132133 predicted 1528
7 SASI_Rn01_00132134 predicted 1756
8 SASI_Rn01_00132135 predicted 1272
9 SASI_Rn01_00132136 predicted 1112
10 SASI_Rn01_00132137 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095970 predicted 1203
2 SASI_Mm01_00095971 predicted 1265
3 SASI_Mm01_00095972 predicted 1286
4 SASI_Mm01_00095973 predicted 1715
5 SASI_Mm01_00095974 predicted 2530
6 SASI_Mm01_00095975 predicted 749
7 SASI_Mm02_00345354 predicted 2025
8 SASI_Mm01_00095976 predicted 836
9 SASI_Mm02_00345355 predicted 618
10 SASI_Mm01_00095978 predicted 2481
11 SASI_Mm01_00095977 predicted 2751
12 SASI_Mm01_00095979 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004441
EPHB1 MISSION shRNA Bacterial Glycerol Stock
EPH receptor B1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004441.x-3623s1c1
Sequence:CCGGCACTCGTTTCCCTTTGCTCATCTCGAGATGAGCAAAGGGAAACGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004441.x-712s1c1
Sequence:CCGGGCCTCTTACTCGGAATGGTTTCTCGAGAAACCATTCCGAGTAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004441.x-2416s1c1
Sequence:CCGGCCTGGCTGAGATGAATTATGTCTCGAGACATAATTCATCTCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004441.x-260s1c1
Sequence:CCGGGCTGCGATGGAAGAAACGTTACTCGAGTAACGTTTCTTCCATCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004441.3-1792s1c1
Sequence:CCGGGACTCTGACTGACGATGATTACTCGAGTAATCATCGTCAGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004441.3-3073s1c1
Sequence:CCGGCCTGAGAATAGGCATCACCTTCTCGAGAAGGTGATGCCTATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004441.3-1764s1c1
Sequence:CCGGGCAAGTTCAGTGGCAAGATGTCTCGAGACATCTTGCCACTGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-1617s21c1
Sequence:CCGGACTATGAGATCCGGTACTATGCTCGAGCATAGTACCGGATCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-1123s21c1
Sequence:CCGGCACCTGTCGGACCGGTTATTACTCGAGTAATAACCGGTCCGACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-1908s21c1
Sequence:CCGGGTAGCAGGAAACGGGCTTATACTCGAGTATAAGCCCGTTTCCTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-267s21c1
Sequence:CCGGCTGCGATGGAAGAAACGTTAACTCGAGTTAACGTTTCTTCCATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004441
EPHB1 MISSION shRNA shRNA Plasmid DNA
EPH receptor B1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004441.x-3623s1c1
Sequence:CCGGCACTCGTTTCCCTTTGCTCATCTCGAGATGAGCAAAGGGAAACGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004441.x-712s1c1
Sequence:CCGGGCCTCTTACTCGGAATGGTTTCTCGAGAAACCATTCCGAGTAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004441.x-2416s1c1
Sequence:CCGGCCTGGCTGAGATGAATTATGTCTCGAGACATAATTCATCTCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004441.x-260s1c1
Sequence:CCGGGCTGCGATGGAAGAAACGTTACTCGAGTAACGTTTCTTCCATCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004441.3-1792s1c1
Sequence:CCGGGACTCTGACTGACGATGATTACTCGAGTAATCATCGTCAGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004441.3-3073s1c1
Sequence:CCGGCCTGAGAATAGGCATCACCTTCTCGAGAAGGTGATGCCTATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004441.3-1764s1c1
Sequence:CCGGGCAAGTTCAGTGGCAAGATGTCTCGAGACATCTTGCCACTGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-1617s21c1
Sequence:CCGGACTATGAGATCCGGTACTATGCTCGAGCATAGTACCGGATCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-1123s21c1
Sequence:CCGGCACCTGTCGGACCGGTTATTACTCGAGTAATAACCGGTCCGACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-1908s21c1
Sequence:CCGGGTAGCAGGAAACGGGCTTATACTCGAGTATAAGCCCGTTTCCTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-267s21c1
Sequence:CCGGCTGCGATGGAAGAAACGTTAACTCGAGTTAACGTTTCTTCCATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004441
EPHB1 MISSION shRNA Lentiviral Transduction Particles
EPH receptor B1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004441.x-3623s1c1
Sequence:CCGGCACTCGTTTCCCTTTGCTCATCTCGAGATGAGCAAAGGGAAACGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004441.x-712s1c1
Sequence:CCGGGCCTCTTACTCGGAATGGTTTCTCGAGAAACCATTCCGAGTAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004441.x-2416s1c1
Sequence:CCGGCCTGGCTGAGATGAATTATGTCTCGAGACATAATTCATCTCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004441.x-260s1c1
Sequence:CCGGGCTGCGATGGAAGAAACGTTACTCGAGTAACGTTTCTTCCATCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004441.3-1792s1c1
Sequence:CCGGGACTCTGACTGACGATGATTACTCGAGTAATCATCGTCAGTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004441.3-3073s1c1
Sequence:CCGGCCTGAGAATAGGCATCACCTTCTCGAGAAGGTGATGCCTATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004441.3-1764s1c1
Sequence:CCGGGCAAGTTCAGTGGCAAGATGTCTCGAGACATCTTGCCACTGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-1617s21c1
Sequence:CCGGACTATGAGATCCGGTACTATGCTCGAGCATAGTACCGGATCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-1123s21c1
Sequence:CCGGCACCTGTCGGACCGGTTATTACTCGAGTAATAACCGGTCCGACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-1908s21c1
Sequence:CCGGGTAGCAGGAAACGGGCTTATACTCGAGTATAAGCCCGTTTCCTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004441.3-267s21c1
Sequence:CCGGCTGCGATGGAAGAAACGTTAACTCGAGTTAACGTTTCTTCCATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173447
EPHB1 MISSION shRNA Bacterial Glycerol Stock
EPH receptor B1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-792s1c1
Sequence:CCGGGCCTCTTACTAGGAACGGTTTCTCGAGAAACCGTTCCTAGTAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-2014s1c1
Sequence:CCGGGCGTACAGTGATAAGCTTCAACTCGAGTTGAAGCTTATCACTGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-540s1c1
Sequence:CCGGCCATCGCATCTATACAGAGATCTCGAGATCTCTGTATAGATGCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-1286s1c1
Sequence:CCGGCCATCGTGAATGAGACATCTACTCGAGTAGATGTCTCATTCACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-2215s1c1
Sequence:CCGGCCAGGCAAGAGGGAAATCTATCTCGAGATAGATTTCCCTCTTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-2678s21c1
Sequence:CCGGCCATCGCCTACCGCAAGTTTACTCGAGTAAACTTGCGGTAGGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-1666s21c1
Sequence:CCGGGAGCAACCCAATGGCATAATCCTCGAGGATTATGCCATTGGGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-2364s21c1
Sequence:CCGGCCGGCCTGTCATGATCATTACCTCGAGGTAATGATCATGACAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-2105s21c1
Sequence:CCGGATGAAGCCGTCCGGGAATTTGCTCGAGCAAATTCCCGGACGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173447
EPHB1 MISSION shRNA shRNA Plasmid DNA
EPH receptor B1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-792s1c1
Sequence:CCGGGCCTCTTACTAGGAACGGTTTCTCGAGAAACCGTTCCTAGTAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-2014s1c1
Sequence:CCGGGCGTACAGTGATAAGCTTCAACTCGAGTTGAAGCTTATCACTGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-540s1c1
Sequence:CCGGCCATCGCATCTATACAGAGATCTCGAGATCTCTGTATAGATGCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-1286s1c1
Sequence:CCGGCCATCGTGAATGAGACATCTACTCGAGTAGATGTCTCATTCACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-2215s1c1
Sequence:CCGGCCAGGCAAGAGGGAAATCTATCTCGAGATAGATTTCCCTCTTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-2678s21c1
Sequence:CCGGCCATCGCCTACCGCAAGTTTACTCGAGTAAACTTGCGGTAGGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-1666s21c1
Sequence:CCGGGAGCAACCCAATGGCATAATCCTCGAGGATTATGCCATTGGGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-2364s21c1
Sequence:CCGGCCGGCCTGTCATGATCATTACCTCGAGGTAATGATCATGACAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-2105s21c1
Sequence:CCGGATGAAGCCGTCCGGGAATTTGCTCGAGCAAATTCCCGGACGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173447
EPHB1 MISSION shRNA Lentiviral Transduction Particles
EPH receptor B1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-792s1c1
Sequence:CCGGGCCTCTTACTAGGAACGGTTTCTCGAGAAACCGTTCCTAGTAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-2014s1c1
Sequence:CCGGGCGTACAGTGATAAGCTTCAACTCGAGTTGAAGCTTATCACTGTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-540s1c1
Sequence:CCGGCCATCGCATCTATACAGAGATCTCGAGATCTCTGTATAGATGCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-1286s1c1
Sequence:CCGGCCATCGTGAATGAGACATCTACTCGAGTAGATGTCTCATTCACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173447.2-2215s1c1
Sequence:CCGGCCAGGCAAGAGGGAAATCTATCTCGAGATAGATTTCCCTCTTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-2678s21c1
Sequence:CCGGCCATCGCCTACCGCAAGTTTACTCGAGTAAACTTGCGGTAGGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-1666s21c1
Sequence:CCGGGAGCAACCCAATGGCATAATCCTCGAGGATTATGCCATTGGGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-2364s21c1
Sequence:CCGGCCGGCCTGTCATGATCATTACCTCGAGGTAATGATCATGACAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173447.2-2105s21c1
Sequence:CCGGATGAAGCCGTCCGGGAATTTGCTCGAGCAAATTCCCGGACGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks