EMAIL THIS PAGE TO A FRIEND

EPHB3

EPH receptor B3

Synonyms: ETK2 HEK2 TYRO6
UniProtKB ID: P54753, Q7Z740
Gene ID:
Human(2049) Summary: Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
Mouse(13845) Eph receptor B3
Rat(287989) Eph receptor B3
chicken(396179) EPH receptor B3
dog(488108) EPH receptor B3
Horse(100067381) EPH receptor B3
cow(540907) EPH receptor B3
domestic cat(101094200) EPH receptor B3
sheep(101106389) EPH receptor B3
Domestic Rabbit(100347330) EPH receptor B3
naked mole-rat(101702571) EPH receptor B3
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E4782 Anti-EPHB3 (167-180) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
E4904 Anti-EphB3 antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, western blot pricing
SAB1405764 Anti-EPHB3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1411942 ANTI-EPHB3 antibody produced in mouse clone 2G8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411943 ANTI-EPHB3 antibody produced in mouse clone 4E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412303 ANTI-EPHB3 antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412401 ANTI-EPHB3 antibody produced in mouse clone 3F12, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA007698 Anti-EPHB3 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA008184 Anti-EPHB3 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1304735 ANTI-MOUSE EPHB3 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
WH0002049M2 Monoclonal Anti-EPHB3 antibody produced in mouse clone 1E12, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunohistochemistry, western blot pricing
SAB5300479 Monoclonal Anti-EPHB3 antibody produced in mouse clone 4A122D1, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB1403782 Monoclonal Anti-EPHB3, (C-terminal) antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004443 Rosetta Predictions human pricing
NM_001105868 Rosetta Predictions rat pricing
NM_010143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178147 predicted 1746
2 SASI_Hs02_00337622 predicted 1474
3 SASI_Hs01_00178150 predicted 3317
4 SASI_Hs01_00178151 predicted 2278
5 SASI_Hs01_00178152 predicted 1695
6 SASI_Hs01_00178153 predicted 2549
7 SASI_Hs01_00178154 predicted 1876
8 SASI_Hs01_00178155 predicted 2869
9 SASI_Hs02_00337623 predicted 3483
10 SASI_Hs02_00337624 predicted 2797
11 SASI_Hs01_00178148 predicted 1192
12 SASI_Hs01_00178149 predicted 3233
13 SASI_Hs01_00178156 predicted 1801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213322 predicted 3397
2 SASI_Rn02_00213323 predicted 1661
3 SASI_Rn02_00213324 predicted 2240
4 SASI_Rn02_00213325 predicted 3274
5 SASI_Rn02_00213326 predicted 2280
6 SASI_Rn02_00213327 predicted 1412
7 SASI_Rn02_00213328 predicted 1831
8 SASI_Rn02_00213329 predicted 1495
9 SASI_Rn02_00213330 predicted 2450
10 SASI_Rn02_00213331 predicted 2442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317884 predicted 1802
2 SASI_Mm01_00021052 predicted 2397
3 SASI_Mm01_00021053 predicted 1310
4 SASI_Mm01_00021054 predicted 2248
5 SASI_Mm01_00021055 predicted 2151
6 SASI_Mm01_00021056 predicted 2200
7 SASI_Mm01_00021057 predicted 3012
8 SASI_Mm02_00317885 predicted 3009
9 SASI_Mm01_00021058 predicted 2516
10 SASI_Mm01_00021059 predicted 2533
11 SASI_Mm01_00021060 predicted 2905
12 SASI_Mm01_00021061 predicted 2670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004443
VALIDATED
EPHB3 MISSION shRNA Bacterial Glycerol Stock
EPH receptor B3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004443.3-2231s1c1
Sequence:CCGGGCAGTACATTGCTCCTGGAATCTCGAGATTCCAGGAGCAATGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004443.3-3611s1c1
Sequence:CCGGCCCAAACCTCTTCATATTGAACTCGAGTTCAATATGAAGAGGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004443.3-1895s1c1
Sequence:CCGGCGAGATGAAGTACTTTGAGAACTCGAGTTCTCAAAGTACTTCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004443.3-3214s1c1
Sequence:CCGGCCTTCACGACAGTTGGTGATTCTCGAGAATCACCAACTGTCGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004443.3-595s1c1
Sequence:CCGGCGTGGACATCTCATCCAGAAACTCGAGTTTCTGGATGAGATGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004443.3-3321s1c1
Sequence:CCGGGCAGAAGACCTGCTCCGTATTCTCGAGAATACGGAGCAGGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004443.3-3914s21c1
Sequence:CCGGTCCAGTTTGCACAGGGATTTGCTCGAGCAAATCCCTGTGCAAACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-1764s21c1
Sequence:CCGGGCCGTGAATATCACCACAAACCTCGAGGTTTGTGGTGATATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-3215s21c1
Sequence:CCGGCTTCACGACAGTTGGTGATTGCTCGAGCAATCACCAACTGTCGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-1386s21c1
Sequence:CCGGATCTGCACCTGCCACAATAACCTCGAGGTTATTGTGGCAGGTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004443.3-3966s21c1
Sequence:CCGGCGCCCTTGGTGCTGTCATAAACTCGAGTTTATGACAGCACCAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-2272s21c1
Sequence:CCGGTTACCTACGAGGACCCTAATGCTCGAGCATTAGGGTCCTCGTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-637s21c1
Sequence:CCGGGCTACGATGAGGCCATGAATCCTCGAGGATTCATGGCCTCATCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-3321s21c1
Sequence:CCGGGCAGAAGACCTGCTCCGTATTCTCGAGAATACGGAGCAGGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004443
VALIDATED
EPHB3 MISSION shRNA shRNA Plasmid DNA
EPH receptor B3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004443.3-2231s1c1
Sequence:CCGGGCAGTACATTGCTCCTGGAATCTCGAGATTCCAGGAGCAATGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004443.3-3611s1c1
Sequence:CCGGCCCAAACCTCTTCATATTGAACTCGAGTTCAATATGAAGAGGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004443.3-1895s1c1
Sequence:CCGGCGAGATGAAGTACTTTGAGAACTCGAGTTCTCAAAGTACTTCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004443.3-3214s1c1
Sequence:CCGGCCTTCACGACAGTTGGTGATTCTCGAGAATCACCAACTGTCGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004443.3-595s1c1
Sequence:CCGGCGTGGACATCTCATCCAGAAACTCGAGTTTCTGGATGAGATGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004443.3-3321s1c1
Sequence:CCGGGCAGAAGACCTGCTCCGTATTCTCGAGAATACGGAGCAGGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004443.3-3914s21c1
Sequence:CCGGTCCAGTTTGCACAGGGATTTGCTCGAGCAAATCCCTGTGCAAACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-1764s21c1
Sequence:CCGGGCCGTGAATATCACCACAAACCTCGAGGTTTGTGGTGATATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-3215s21c1
Sequence:CCGGCTTCACGACAGTTGGTGATTGCTCGAGCAATCACCAACTGTCGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-1386s21c1
Sequence:CCGGATCTGCACCTGCCACAATAACCTCGAGGTTATTGTGGCAGGTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004443.3-3966s21c1
Sequence:CCGGCGCCCTTGGTGCTGTCATAAACTCGAGTTTATGACAGCACCAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-2272s21c1
Sequence:CCGGTTACCTACGAGGACCCTAATGCTCGAGCATTAGGGTCCTCGTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-637s21c1
Sequence:CCGGGCTACGATGAGGCCATGAATCCTCGAGGATTCATGGCCTCATCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-3321s21c1
Sequence:CCGGGCAGAAGACCTGCTCCGTATTCTCGAGAATACGGAGCAGGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004443
VALIDATED
EPHB3 MISSION shRNA Lentiviral Transduction Particles
EPH receptor B3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004443.3-2231s1c1
Sequence:CCGGGCAGTACATTGCTCCTGGAATCTCGAGATTCCAGGAGCAATGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004443.3-3611s1c1
Sequence:CCGGCCCAAACCTCTTCATATTGAACTCGAGTTCAATATGAAGAGGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004443.3-1895s1c1
Sequence:CCGGCGAGATGAAGTACTTTGAGAACTCGAGTTCTCAAAGTACTTCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004443.3-3214s1c1
Sequence:CCGGCCTTCACGACAGTTGGTGATTCTCGAGAATCACCAACTGTCGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004443.3-595s1c1
Sequence:CCGGCGTGGACATCTCATCCAGAAACTCGAGTTTCTGGATGAGATGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004443.3-3321s1c1
Sequence:CCGGGCAGAAGACCTGCTCCGTATTCTCGAGAATACGGAGCAGGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004443.3-3914s21c1
Sequence:CCGGTCCAGTTTGCACAGGGATTTGCTCGAGCAAATCCCTGTGCAAACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-1764s21c1
Sequence:CCGGGCCGTGAATATCACCACAAACCTCGAGGTTTGTGGTGATATTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-3215s21c1
Sequence:CCGGCTTCACGACAGTTGGTGATTGCTCGAGCAATCACCAACTGTCGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-1386s21c1
Sequence:CCGGATCTGCACCTGCCACAATAACCTCGAGGTTATTGTGGCAGGTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004443.3-3966s21c1
Sequence:CCGGCGCCCTTGGTGCTGTCATAAACTCGAGTTTATGACAGCACCAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-2272s21c1
Sequence:CCGGTTACCTACGAGGACCCTAATGCTCGAGCATTAGGGTCCTCGTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-637s21c1
Sequence:CCGGGCTACGATGAGGCCATGAATCCTCGAGGATTCATGGCCTCATCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004443.3-3321s21c1
Sequence:CCGGGCAGAAGACCTGCTCCGTATTCTCGAGAATACGGAGCAGGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010143
EPHB3 MISSION shRNA Bacterial Glycerol Stock
EPH receptor B3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-2786s1c1
Sequence:CCGGCCATAGCCTATCGGAAGTTTACTCGAGTAAACTTCCGATAGGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-3244s1c1
Sequence:CCGGGCAGAAGATCTGCTAAGGATTCTCGAGAATCCTTAGCAGATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-577s1c1
Sequence:CCGGCGCACGTATCAGGTGTGTAATCTCGAGATTACACACCTGATACGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-2407s1c1
Sequence:CCGGGCTTCCATTATGGGTCAGTTTCTCGAGAAACTGACCCATAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-1299s21c1
Sequence:CCGGCATCTGCACCTGCCATAATAACTCGAGTTATTATGGCAGGTGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-3113s21c1
Sequence:CCGGACCGCACAGTCCCAGATTATACTCGAGTATAATCTGGGACTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-1943s21c1
Sequence:CCGGTAGCGGGTTACGGACAGTATACTCGAGTATACTGTCCGTAACCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-1814s21c1
Sequence:CCGGACTATGAGATGAAGTACTTTGCTCGAGCAAAGTACTTCATCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010143
EPHB3 MISSION shRNA shRNA Plasmid DNA
EPH receptor B3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-2786s1c1
Sequence:CCGGCCATAGCCTATCGGAAGTTTACTCGAGTAAACTTCCGATAGGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-3244s1c1
Sequence:CCGGGCAGAAGATCTGCTAAGGATTCTCGAGAATCCTTAGCAGATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-577s1c1
Sequence:CCGGCGCACGTATCAGGTGTGTAATCTCGAGATTACACACCTGATACGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-2407s1c1
Sequence:CCGGGCTTCCATTATGGGTCAGTTTCTCGAGAAACTGACCCATAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-1299s21c1
Sequence:CCGGCATCTGCACCTGCCATAATAACTCGAGTTATTATGGCAGGTGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-3113s21c1
Sequence:CCGGACCGCACAGTCCCAGATTATACTCGAGTATAATCTGGGACTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-1943s21c1
Sequence:CCGGTAGCGGGTTACGGACAGTATACTCGAGTATACTGTCCGTAACCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-1814s21c1
Sequence:CCGGACTATGAGATGAAGTACTTTGCTCGAGCAAAGTACTTCATCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010143
EPHB3 MISSION shRNA Lentiviral Transduction Particles
EPH receptor B3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-2786s1c1
Sequence:CCGGCCATAGCCTATCGGAAGTTTACTCGAGTAAACTTCCGATAGGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-3244s1c1
Sequence:CCGGGCAGAAGATCTGCTAAGGATTCTCGAGAATCCTTAGCAGATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-577s1c1
Sequence:CCGGCGCACGTATCAGGTGTGTAATCTCGAGATTACACACCTGATACGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010143.1-2407s1c1
Sequence:CCGGGCTTCCATTATGGGTCAGTTTCTCGAGAAACTGACCCATAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-1299s21c1
Sequence:CCGGCATCTGCACCTGCCATAATAACTCGAGTTATTATGGCAGGTGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-3113s21c1
Sequence:CCGGACCGCACAGTCCCAGATTATACTCGAGTATAATCTGGGACTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-1943s21c1
Sequence:CCGGTAGCGGGTTACGGACAGTATACTCGAGTATACTGTCCGTAACCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010143.1-1814s21c1
Sequence:CCGGACTATGAGATGAAGTACTTTGCTCGAGCAAAGTACTTCATCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks