EMAIL THIS PAGE TO A FRIEND

EPHB4

EPH receptor B4

122 Gene Product Result for
Synonyms: HTK MYK1 TYRO11
UniProtKB ID: P54760, Q9BTA5, Q9BXP0
Gene ID:
Human(2050) Summary: Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
Mouse(13846) Eph receptor B4
Rat(686310) EPH receptor B4
dog(489830) EPH receptor B4
Horse(100069098) EPH receptor B4
cow(515756) EPH receptor B4
domestic cat(101094226) EPH receptor B4
naked mole-rat(101709678) EPH receptor B4
sheep(101120886) EPH receptor B4
Domestic Rabbit(100359286) EPH receptor B4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004444 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004444 siRNAs that have been validated in the lab human pricing
XM_001069322 Rosetta Predictions rat pricing
XM_001069363 Rosetta Predictions rat pricing
XM_001069404 Rosetta Predictions rat pricing
XM_001069453 Rosetta Predictions rat pricing
NM_010144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004444 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039857 validated 1361
2 SASI_Hs01_00039855 predicted 1742
3 SASI_Hs01_00039856 predicted 574
4 SASI_Hs01_00039858 predicted 2281
5 SASI_Hs01_00039859 predicted 2319
6 SASI_Hs01_00039860 predicted 2340
7 SASI_Hs01_00039861 predicted 2901
8 SASI_Hs01_00039862 predicted 2247
9 SASI_Hs01_00039863 predicted 1681
10 SASI_Hs01_00039864 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327621 predicted 2751
2 SASI_Rn02_00327622 predicted 3531
3 SASI_Rn02_00327623 predicted 805
4 SASI_Rn02_00327624 predicted 1758
5 SASI_Rn02_00327625 predicted 650
6 SASI_Rn02_00327626 predicted 1465
7 SASI_Rn02_00327627 predicted 2290
8 SASI_Rn02_00327628 predicted 2215
9 SASI_Rn02_00327629 predicted 1928
10 SASI_Rn02_00327630 predicted 1708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327776 predicted 2758
2 SASI_Rn02_00327777 predicted 3545
3 SASI_Rn02_00327778 predicted 811
4 SASI_Rn02_00327779 predicted 1755
5 SASI_Rn02_00327780 predicted 648
6 SASI_Rn02_00327781 predicted 1474
7 SASI_Rn02_00327782 predicted 654
8 SASI_Rn02_00327783 predicted 2289
9 SASI_Rn02_00327784 predicted 2214
10 SASI_Rn02_00327785 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327867 predicted 2778
2 SASI_Rn02_00327868 predicted 3561
3 SASI_Rn02_00327869 predicted 808
4 SASI_Rn02_00327870 predicted 648
5 SASI_Rn02_00327871 predicted 1472
6 SASI_Rn02_00327872 predicted 646
7 SASI_Rn02_00327873 predicted 2319
8 SASI_Rn02_00327874 predicted 2243
9 SASI_Rn02_00327875 predicted 1961
10 SASI_Rn02_00327876 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328137 predicted 2752
2 SASI_Rn02_00328138 predicted 3531
3 SASI_Rn02_00328139 predicted 812
4 SASI_Rn02_00328140 predicted 1758
5 SASI_Rn02_00328141 predicted 653
6 SASI_Rn02_00328142 predicted 1471
7 SASI_Rn02_00328143 predicted 2292
8 SASI_Rn02_00328144 predicted 2222
9 SASI_Rn02_00328145 predicted 1931
10 SASI_Rn02_00328146 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184916 predicted 1641
2 SASI_Mm01_00184917 predicted 2151
3 SASI_Mm01_00184918 predicted 760
4 SASI_Mm01_00184919 predicted 2263
5 SASI_Mm01_00184920 predicted 1705
6 SASI_Mm01_00184921 predicted 863
7 SASI_Mm01_00184922 predicted 2503
8 SASI_Mm01_00184923 predicted 799
9 SASI_Mm01_00184924 predicted 607
10 SASI_Mm01_00184925 predicted 2164
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004444
VALIDATED
EPHB4 MISSION shRNA Bacterial Glycerol Stock
EPH receptor B4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2965s21c1
Sequence:CCGGGCAATCAGGACGTGATCAATGCTCGAGCATTGATCACGTCCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2272s21c1
Sequence:CCGGTCACTTATGAAGACCCTAATGCTCGAGCATTAGGGTCTTCATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2545s21c1
Sequence:CCGGACAGCATGCCCGTCATGATTCCTCGAGGAATCATGACGGGCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004444.4-3900s21c1
Sequence:CCGGCACCACCAAACTCAATCATTTCTCGAGAAATGATTGAGTTTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2235s21c1
Sequence:CCGGCTCATCGGACATGGTACTAAGCTCGAGCTTAGTACCATGTCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004444.4-653s1c1
Sequence:CCGGCGTGCGCACCTACGAAGTGTGCTCGAGCACACTTCGTAGGTGCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004444.4-2555s1c1
Sequence:CCGGCGTCATGATTCTCACAGAGTTCTCGAGAACTCTGTGAGAATCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004444.x-975s1c1
Sequence:CCGGGACTGTGAACCTGACTCGATTCTCGAGAATCGAGTCAGGTTCACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004444.x-2076s1c1
Sequence:CCGGCAATGGGAGAGAAGCAGAATACTCGAGTATTCTGCTTCTCTCCCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004444.x-459s1c1
Sequence:CCGGTGATCTGAAGTGGGTGACATTCTCGAGAATGTCACCCACTTCAGATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004444
VALIDATED
EPHB4 MISSION shRNA shRNA Plasmid DNA
EPH receptor B4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2965s21c1
Sequence:CCGGGCAATCAGGACGTGATCAATGCTCGAGCATTGATCACGTCCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2272s21c1
Sequence:CCGGTCACTTATGAAGACCCTAATGCTCGAGCATTAGGGTCTTCATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2545s21c1
Sequence:CCGGACAGCATGCCCGTCATGATTCCTCGAGGAATCATGACGGGCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004444.4-3900s21c1
Sequence:CCGGCACCACCAAACTCAATCATTTCTCGAGAAATGATTGAGTTTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2235s21c1
Sequence:CCGGCTCATCGGACATGGTACTAAGCTCGAGCTTAGTACCATGTCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004444.4-653s1c1
Sequence:CCGGCGTGCGCACCTACGAAGTGTGCTCGAGCACACTTCGTAGGTGCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004444.4-2555s1c1
Sequence:CCGGCGTCATGATTCTCACAGAGTTCTCGAGAACTCTGTGAGAATCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004444.x-975s1c1
Sequence:CCGGGACTGTGAACCTGACTCGATTCTCGAGAATCGAGTCAGGTTCACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004444.x-2076s1c1
Sequence:CCGGCAATGGGAGAGAAGCAGAATACTCGAGTATTCTGCTTCTCTCCCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004444.x-459s1c1
Sequence:CCGGTGATCTGAAGTGGGTGACATTCTCGAGAATGTCACCCACTTCAGATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004444
VALIDATED
EPHB4 MISSION shRNA Lentiviral Transduction Particles
EPH receptor B4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2965s21c1
Sequence:CCGGGCAATCAGGACGTGATCAATGCTCGAGCATTGATCACGTCCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2272s21c1
Sequence:CCGGTCACTTATGAAGACCCTAATGCTCGAGCATTAGGGTCTTCATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2545s21c1
Sequence:CCGGACAGCATGCCCGTCATGATTCCTCGAGGAATCATGACGGGCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004444.4-3900s21c1
Sequence:CCGGCACCACCAAACTCAATCATTTCTCGAGAAATGATTGAGTTTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004444.4-2235s21c1
Sequence:CCGGCTCATCGGACATGGTACTAAGCTCGAGCTTAGTACCATGTCCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004444.4-653s1c1
Sequence:CCGGCGTGCGCACCTACGAAGTGTGCTCGAGCACACTTCGTAGGTGCGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004444.4-2555s1c1
Sequence:CCGGCGTCATGATTCTCACAGAGTTCTCGAGAACTCTGTGAGAATCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004444.x-975s1c1
Sequence:CCGGGACTGTGAACCTGACTCGATTCTCGAGAATCGAGTCAGGTTCACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004444.x-2076s1c1
Sequence:CCGGCAATGGGAGAGAAGCAGAATACTCGAGTATTCTGCTTCTCTCCCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004444.x-459s1c1
Sequence:CCGGTGATCTGAAGTGGGTGACATTCTCGAGAATGTCACCCACTTCAGATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010144
VALIDATED
EPHB4 MISSION shRNA Bacterial Glycerol Stock
EPH receptor B4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-1347s21c1
Sequence:CCGGCCTGTGTCGAATTGGGTATTACTCGAGTAATACCCAATTCGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-1308s21c1
Sequence:CCGGAGCCAACAGCCACTCGAATAACTCGAGTTATTCGAGTGGCTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-524s21c1
Sequence:CCGGCGGATCTGAAATGGGTGACTTCTCGAGAAGTCACCCATTTCAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010144.5-3846s21c1
Sequence:CCGGCACCACCAAAGGCAATCATTTCTCGAGAAATGATTGCCTTTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-1842s21c1
Sequence:CCGGCGAGGTCAAGTATCATGAGAACTCGAGTTCTCATGATACTTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010144.2-83s1c1
Sequence:CCGGCGGATCTGAAATGGGTGACTTCTCGAGAAGTCACCCATTTCAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010144.2-906s1c1
Sequence:CCGGCCTGTGTCGAATTGGGTATTACTCGAGTAATACCCAATTCGACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010144.2-2063s1c1
Sequence:CCGGCGGTTATGATCCTCACGGAATCTCGAGATTCCGTGAGGATCATAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010144.2-1401s1c1
Sequence:CCGGCGAGGTCAAGTATCATGAGAACTCGAGTTCTCATGATACTTGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010144
VALIDATED
EPHB4 MISSION shRNA shRNA Plasmid DNA
EPH receptor B4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-1347s21c1
Sequence:CCGGCCTGTGTCGAATTGGGTATTACTCGAGTAATACCCAATTCGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-1308s21c1
Sequence:CCGGAGCCAACAGCCACTCGAATAACTCGAGTTATTCGAGTGGCTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-524s21c1
Sequence:CCGGCGGATCTGAAATGGGTGACTTCTCGAGAAGTCACCCATTTCAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010144.5-3846s21c1
Sequence:CCGGCACCACCAAAGGCAATCATTTCTCGAGAAATGATTGCCTTTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-1842s21c1
Sequence:CCGGCGAGGTCAAGTATCATGAGAACTCGAGTTCTCATGATACTTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010144.2-83s1c1
Sequence:CCGGCGGATCTGAAATGGGTGACTTCTCGAGAAGTCACCCATTTCAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010144.2-906s1c1
Sequence:CCGGCCTGTGTCGAATTGGGTATTACTCGAGTAATACCCAATTCGACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010144.2-2063s1c1
Sequence:CCGGCGGTTATGATCCTCACGGAATCTCGAGATTCCGTGAGGATCATAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010144.2-1401s1c1
Sequence:CCGGCGAGGTCAAGTATCATGAGAACTCGAGTTCTCATGATACTTGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010144
VALIDATED
EPHB4 MISSION shRNA Lentiviral Transduction Particles
EPH receptor B4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-1347s21c1
Sequence:CCGGCCTGTGTCGAATTGGGTATTACTCGAGTAATACCCAATTCGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-1308s21c1
Sequence:CCGGAGCCAACAGCCACTCGAATAACTCGAGTTATTCGAGTGGCTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-524s21c1
Sequence:CCGGCGGATCTGAAATGGGTGACTTCTCGAGAAGTCACCCATTTCAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010144.5-3846s21c1
Sequence:CCGGCACCACCAAAGGCAATCATTTCTCGAGAAATGATTGCCTTTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010144.5-1842s21c1
Sequence:CCGGCGAGGTCAAGTATCATGAGAACTCGAGTTCTCATGATACTTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010144.2-83s1c1
Sequence:CCGGCGGATCTGAAATGGGTGACTTCTCGAGAAGTCACCCATTTCAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010144.2-906s1c1
Sequence:CCGGCCTGTGTCGAATTGGGTATTACTCGAGTAATACCCAATTCGACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010144.2-2063s1c1
Sequence:CCGGCGGTTATGATCCTCACGGAATCTCGAGATTCCGTGAGGATCATAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010144.2-1401s1c1
Sequence:CCGGCGAGGTCAAGTATCATGAGAACTCGAGTTCTCATGATACTTGACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks