EMAIL THIS PAGE TO A FRIEND

EPHB6

EPH receptor B6

68 Gene Product Result for
Synonyms: HEP
UniProtKB ID: O15197, A4D2I7, A8CDT5, D3DXD3, Q2TB23, Q2TB24
Gene ID:
Human(2051) Summary: Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The ephrin receptor encoded by this gene lacks the kinase activity of most receptor tyrosine kinases and binds to ephrin-B ligands. [provided by RefSeq, Jul 2008]
Mouse(13848) Eph receptor B6
Rat(312275) Eph receptor B6
chicken(418308) EPH receptor B6
dog(475519) EPH receptor B6
domestic cat(101085965) EPH receptor B6
Horse(100055465) EPH receptor B6
cow(529800) EPH receptor B6
sheep(101120569) EPH receptor B6
naked mole-rat(101717820) EPH receptor B6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004445 Rosetta Predictions human pricing
NM_001107857 Rosetta Predictions rat pricing
NM_007680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229517 predicted 2806
2 SASI_Hs01_00229518 predicted 2357
3 SASI_Hs02_00337625 predicted 2007
4 SASI_Hs01_00229519 predicted 990
5 SASI_Hs01_00229520 predicted 2552
6 SASI_Hs01_00229521 predicted 2339
7 SASI_Hs01_00229523 predicted 2358
8 SASI_Hs01_00229524 predicted 916
9 SASI_Hs01_00229525 predicted 3360
10 SASI_Hs01_00229526 predicted 1041
11 SASI_Hs01_00229522 predicted 3451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232965 predicted 2355
2 SASI_Rn02_00232966 predicted 3783
3 SASI_Rn02_00232967 predicted 2724
4 SASI_Rn02_00232968 predicted 2790
5 SASI_Rn02_00232969 predicted 3656
6 SASI_Rn02_00232970 predicted 1201
7 SASI_Rn02_00232971 predicted 2152
8 SASI_Rn02_00232972 predicted 1116
9 SASI_Rn02_00232973 predicted 3690
10 SASI_Rn02_00232974 predicted 2331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101286 predicted 3165
2 SASI_Mm01_00101287 predicted 1966
3 SASI_Mm01_00101288 predicted 730
4 SASI_Mm01_00101289 predicted 2903
5 SASI_Mm01_00101290 predicted 492
6 SASI_Mm01_00101291 predicted 3265
7 SASI_Mm01_00101292 predicted 1757
8 SASI_Mm01_00101293 predicted 805
9 SASI_Mm01_00101294 predicted 553
10 SASI_Mm01_00101295 predicted 2325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004445
VALIDATED
EPHB6 MISSION shRNA Bacterial Glycerol Stock
EPH receptor B6
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-1956s1c1
Sequence:CCGGGCTCTTCAATGTCGTGTGCAACTCGAGTTGCACACGACATTGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-1063s1c1
Sequence:CCGGCACATTCGACTCCACTTCTCTCTCGAGAGAGAAGTGGAGTCGAATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-2479s1c1
Sequence:CCGGTATTTCCAGACACTTCCTCAACTCGAGTTGAGGAAGTGTCTGGAAATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-3291s1c1
Sequence:CCGGCTTTGGGATACTCATGTGGGACTCGAGTCCCACATGAGTATCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-3304s1c1
Sequence:CCGGATGTGGGAAGTGATGAGTTATCTCGAGATAACTCATCACTTCCCACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004445.2-1747s1c1
Sequence:CCGGGCTCTATAAGTCTTCTGCTGGCTCGAGCCAGCAGAAGACTTATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004445.2-1159s1c1
Sequence:CCGGCCGGGAGACCTTCACCCTTTACTCGAGTAAAGGGTGAAGGTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004445.2-3877s1c1
Sequence:CCGGCCCTGGACACTGGTCCGAGAACTCGAGTTCTCGGACCAGTGTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004445.2-3706s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-2346s21c1
Sequence:CCGGACTATCAGCTCCGCTACTATGCTCGAGCATAGTAGCGGAGCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-2159s21c1
Sequence:CCGGTTAGAGGTGCAGGCTGTTAATCTCGAGATTAACAGCCTGCACCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004445.3-1359s21c1
Sequence:CCGGGACTGCAACTGAACGTCAAAGCTCGAGCTTTGACGTTCAGTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-3854s21c1
Sequence:CCGGGAATGACGATACCCGTGACTCCTCGAGGAGTCACGGGTATCGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-3382s21c1
Sequence:CCGGGAGTGAGCAGGAGGTACTAAACTCGAGTTTAGTACCTCCTGCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004445
VALIDATED
EPHB6 MISSION shRNA shRNA Plasmid DNA
EPH receptor B6
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-1956s1c1
Sequence:CCGGGCTCTTCAATGTCGTGTGCAACTCGAGTTGCACACGACATTGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-1063s1c1
Sequence:CCGGCACATTCGACTCCACTTCTCTCTCGAGAGAGAAGTGGAGTCGAATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-2479s1c1
Sequence:CCGGTATTTCCAGACACTTCCTCAACTCGAGTTGAGGAAGTGTCTGGAAATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-3291s1c1
Sequence:CCGGCTTTGGGATACTCATGTGGGACTCGAGTCCCACATGAGTATCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-3304s1c1
Sequence:CCGGATGTGGGAAGTGATGAGTTATCTCGAGATAACTCATCACTTCCCACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004445.2-1747s1c1
Sequence:CCGGGCTCTATAAGTCTTCTGCTGGCTCGAGCCAGCAGAAGACTTATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004445.2-1159s1c1
Sequence:CCGGCCGGGAGACCTTCACCCTTTACTCGAGTAAAGGGTGAAGGTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004445.2-3877s1c1
Sequence:CCGGCCCTGGACACTGGTCCGAGAACTCGAGTTCTCGGACCAGTGTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004445.2-3706s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-2346s21c1
Sequence:CCGGACTATCAGCTCCGCTACTATGCTCGAGCATAGTAGCGGAGCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-2159s21c1
Sequence:CCGGTTAGAGGTGCAGGCTGTTAATCTCGAGATTAACAGCCTGCACCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004445.3-1359s21c1
Sequence:CCGGGACTGCAACTGAACGTCAAAGCTCGAGCTTTGACGTTCAGTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-3854s21c1
Sequence:CCGGGAATGACGATACCCGTGACTCCTCGAGGAGTCACGGGTATCGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-3382s21c1
Sequence:CCGGGAGTGAGCAGGAGGTACTAAACTCGAGTTTAGTACCTCCTGCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004445
VALIDATED
EPHB6 MISSION shRNA Lentiviral Transduction Particles
EPH receptor B6
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-1956s1c1
Sequence:CCGGGCTCTTCAATGTCGTGTGCAACTCGAGTTGCACACGACATTGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-1063s1c1
Sequence:CCGGCACATTCGACTCCACTTCTCTCTCGAGAGAGAAGTGGAGTCGAATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-2479s1c1
Sequence:CCGGTATTTCCAGACACTTCCTCAACTCGAGTTGAGGAAGTGTCTGGAAATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-3291s1c1
Sequence:CCGGCTTTGGGATACTCATGTGGGACTCGAGTCCCACATGAGTATCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004445.x-3304s1c1
Sequence:CCGGATGTGGGAAGTGATGAGTTATCTCGAGATAACTCATCACTTCCCACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004445.2-1747s1c1
Sequence:CCGGGCTCTATAAGTCTTCTGCTGGCTCGAGCCAGCAGAAGACTTATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004445.2-1159s1c1
Sequence:CCGGCCGGGAGACCTTCACCCTTTACTCGAGTAAAGGGTGAAGGTCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004445.2-3877s1c1
Sequence:CCGGCCCTGGACACTGGTCCGAGAACTCGAGTTCTCGGACCAGTGTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004445.2-3706s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-2346s21c1
Sequence:CCGGACTATCAGCTCCGCTACTATGCTCGAGCATAGTAGCGGAGCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-2159s21c1
Sequence:CCGGTTAGAGGTGCAGGCTGTTAATCTCGAGATTAACAGCCTGCACCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004445.3-1359s21c1
Sequence:CCGGGACTGCAACTGAACGTCAAAGCTCGAGCTTTGACGTTCAGTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-3854s21c1
Sequence:CCGGGAATGACGATACCCGTGACTCCTCGAGGAGTCACGGGTATCGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004445.3-3382s21c1
Sequence:CCGGGAGTGAGCAGGAGGTACTAAACTCGAGTTTAGTACCTCCTGCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007680
VALIDATED
EPHB6 MISSION shRNA Bacterial Glycerol Stock
EPH receptor B6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-2795s1c1
Sequence:CCGGCCCGAAGTGTGCTAGTGAATACTCGAGTATTCACTAGCACACTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-1927s1c1
Sequence:CCGGCCACAGCCTGAGCAAACAAATCTCGAGATTTGTTTGCTCAGGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-3063s1c1
Sequence:CCGGCCCTGGACTACATCTACTGATCTCGAGATCAGTAGATGTAGTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-2389s1c1
Sequence:CCGGCGAGAGGTTGACCCTACATATCTCGAGATATGTAGGGTCAACCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007680.2-880s1c1
Sequence:CCGGTGGACCAAAGTGGACACAATTCTCGAGAATTGTGTCCACTTTGGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-2012s21c1
Sequence:CCGGCCACAGCCTGAGCAAACAAATCTCGAGATTTGTTTGCTCAGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-3082s21c1
Sequence:CCGGGAACGAGCAGGAGGTACTAAACTCGAGTTTAGTACCTCCTGCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-3148s21c1
Sequence:CCGGCCCTGGACTACATCTACTGATCTCGAGATCAGTAGATGTAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-2474s21c1
Sequence:CCGGCGAGAGGTTGACCCTACATATCTCGAGATATGTAGGGTCAACCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-2880s21c1
Sequence:CCGGCCCGAAGTGTGCTAGTGAATACTCGAGTATTCACTAGCACACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007680
VALIDATED
EPHB6 MISSION shRNA shRNA Plasmid DNA
EPH receptor B6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-2795s1c1
Sequence:CCGGCCCGAAGTGTGCTAGTGAATACTCGAGTATTCACTAGCACACTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-1927s1c1
Sequence:CCGGCCACAGCCTGAGCAAACAAATCTCGAGATTTGTTTGCTCAGGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-3063s1c1
Sequence:CCGGCCCTGGACTACATCTACTGATCTCGAGATCAGTAGATGTAGTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-2389s1c1
Sequence:CCGGCGAGAGGTTGACCCTACATATCTCGAGATATGTAGGGTCAACCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007680.2-880s1c1
Sequence:CCGGTGGACCAAAGTGGACACAATTCTCGAGAATTGTGTCCACTTTGGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-2012s21c1
Sequence:CCGGCCACAGCCTGAGCAAACAAATCTCGAGATTTGTTTGCTCAGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-3082s21c1
Sequence:CCGGGAACGAGCAGGAGGTACTAAACTCGAGTTTAGTACCTCCTGCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-3148s21c1
Sequence:CCGGCCCTGGACTACATCTACTGATCTCGAGATCAGTAGATGTAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-2474s21c1
Sequence:CCGGCGAGAGGTTGACCCTACATATCTCGAGATATGTAGGGTCAACCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-2880s21c1
Sequence:CCGGCCCGAAGTGTGCTAGTGAATACTCGAGTATTCACTAGCACACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007680
VALIDATED
EPHB6 MISSION shRNA Lentiviral Transduction Particles
EPH receptor B6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-2795s1c1
Sequence:CCGGCCCGAAGTGTGCTAGTGAATACTCGAGTATTCACTAGCACACTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-1927s1c1
Sequence:CCGGCCACAGCCTGAGCAAACAAATCTCGAGATTTGTTTGCTCAGGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-3063s1c1
Sequence:CCGGCCCTGGACTACATCTACTGATCTCGAGATCAGTAGATGTAGTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007680.2-2389s1c1
Sequence:CCGGCGAGAGGTTGACCCTACATATCTCGAGATATGTAGGGTCAACCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007680.2-880s1c1
Sequence:CCGGTGGACCAAAGTGGACACAATTCTCGAGAATTGTGTCCACTTTGGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-2012s21c1
Sequence:CCGGCCACAGCCTGAGCAAACAAATCTCGAGATTTGTTTGCTCAGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-3082s21c1
Sequence:CCGGGAACGAGCAGGAGGTACTAAACTCGAGTTTAGTACCTCCTGCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-3148s21c1
Sequence:CCGGCCCTGGACTACATCTACTGATCTCGAGATCAGTAGATGTAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-2474s21c1
Sequence:CCGGCGAGAGGTTGACCCTACATATCTCGAGATATGTAGGGTCAACCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007680.4-2880s21c1
Sequence:CCGGCCCGAAGTGTGCTAGTGAATACTCGAGTATTCACTAGCACACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks