EMAIL THIS PAGE TO A FRIEND

EPHX1

epoxide hydrolase 1, microsomal (xenobiotic)

69 Gene Product Result for
Synonyms: EPHX EPOX HYL1 MEH
Gene ID:
Human(2052) Summary: Epoxide hydrolase is a critical biotransformation enzyme that converts epoxides from the degradation of aromatic compounds to trans-dihydrodiols which can be conjugated and excreted from the body. Epoxide hydrolase functions in both the activation and detoxification of epoxides. Mutations in this gene cause preeclampsia, epoxide hydrolase deficiency or increased epoxide hydrolase activity. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2008]
Mouse(13849) epoxide hydrolase 1, microsomal
Rat(25315) epoxide hydrolase 1, microsomal (xenobiotic)
Zebrafish(394043) epoxide hydrolase 1, microsomal (xenobiotic)
dog(480113) epoxide hydrolase 1, microsomal (xenobiotic)
chicken(421321) epoxide hydrolase 1, microsomal (xenobiotic)
cow(535293) epoxide hydrolase 1, microsomal (xenobiotic)
Horse(100054269) epoxide hydrolase 1, microsomal (xenobiotic)
domestic cat(101085519) epoxide hydrolase 1, microsomal (xenobiotic)
naked mole-rat(101725522) epoxide hydrolase 1, microsomal (xenobiotic)
domestic guinea pig(100721931) epoxide hydrolase 1, microsomal (xenobiotic)
Goat(100860945) epoxide hydrolase 1, microsomal (xenobiotic)
Domestic Rabbit(100009104) epoxide hydrolase 1, microsomal (xenobiotic)
sheep(101111038) epoxide hydrolase 1, microsomal (xenobiotic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000120 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000120 Rosetta Predictions human pricing
NM_001034090 Rosetta Predictions rat pricing
NM_012844 Rosetta Predictions rat pricing
NM_010145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247251 predicted 567
2 SASI_Hs01_00247252 predicted 1533
3 SASI_Hs01_00247253 predicted 520
4 SASI_Hs01_00247254 predicted 1271
5 SASI_Hs02_00301908 predicted 1237
6 SASI_Hs01_00247255 predicted 550
7 SASI_Hs01_00247256 predicted 611
8 SASI_Hs01_00247257 predicted 1482
9 SASI_Hs01_00247258 predicted 995
10 SASI_Hs01_00247259 predicted 924
11 SASI_Hs01_00247260 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065112 predicted 1271
2 SASI_Rn02_00203935 predicted 352
3 SASI_Rn01_00065113 predicted 1236
4 SASI_Rn01_00065114 predicted 826
5 SASI_Rn01_00065115 predicted 1390
6 SASI_Rn01_00065116 predicted 833
7 SASI_Rn01_00065117 predicted 909
8 SASI_Rn01_00065118 predicted 1227
9 SASI_Rn01_00065119 predicted 1165
10 SASI_Rn01_00065120 predicted 317
11 SASI_Rn01_00065121 predicted 1222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086878 predicted 1321
2 SASI_Rn02_00260313 predicted 395
3 SASI_Rn01_00086879 predicted 1281
4 SASI_Rn01_00086880 predicted 867
5 SASI_Rn01_00086881 predicted 1433
6 SASI_Rn01_00086882 predicted 881
7 SASI_Rn01_00086883 predicted 950
8 SASI_Rn01_00086884 predicted 1270
9 SASI_Rn01_00086885 predicted 1207
10 SASI_Rn01_00086886 predicted 367
11 SASI_Rn01_00086887 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122593 predicted 529
2 SASI_Mm02_00317886 predicted 665
3 SASI_Mm01_00122594 predicted 396
4 SASI_Mm01_00122595 predicted 588
5 SASI_Mm01_00122596 predicted 585
6 SASI_Mm01_00122597 predicted 874
7 SASI_Mm01_00122598 predicted 1104
8 SASI_Mm01_00122600 predicted 1253
9 SASI_Mm02_00317887 predicted 1131
10 SASI_Mm02_00317888 predicted 801
11 SASI_Mm01_00122599 predicted 238
12 SASI_Mm01_00122601 predicted 297
13 SASI_Mm01_00122602 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010145
VALIDATED
EPHX1 MISSION shRNA Bacterial Glycerol Stock
epoxide hydrolase 1, microsomal (xenobiotic)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-448s21c1
Sequence:CCGGTCCACTTCATCCACGTGAAACCTCGAGGTTTCACGTGGATGAAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-1483s21c1
Sequence:CCGGTTCCTTCCCAGTCATACTTATCTCGAGATAAGTATGACTGGGAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-655s21c1
Sequence:CCGGCCAGCAAGAAAGGTTTAAATTCTCGAGAATTTAAACCTTTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010145.2-263s21c1
Sequence:CCGGGCACCAGAGGATAGATAGGTTCTCGAGAACCTATCTATCCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-800s21c1
Sequence:CCGGCGTGAAAGGTTTGCACTTGAACTCGAGTTCAAGTGCAAACCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-414s1c1
Sequence:CCGGCCACACTTTAAGACCAAGATTCTCGAGAATCTTGGTCTTAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-263s1c1
Sequence:CCGGGCACCAGAGGATAGATAGGTTCTCGAGAACCTATCTATCCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-800s1c1
Sequence:CCGGCGTGAAAGGTTTGCACTTGAACTCGAGTTCAAGTGCAAACCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-1124s1c1
Sequence:CCGGCCTGGAAGATCTGCTGACTAACTCGAGTTAGTCAGCAGATCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-655s1c1
Sequence:CCGGCCAGCAAGAAAGGTTTAAATTCTCGAGAATTTAAACCTTTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010145
VALIDATED
EPHX1 MISSION shRNA shRNA Plasmid DNA
epoxide hydrolase 1, microsomal (xenobiotic)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-448s21c1
Sequence:CCGGTCCACTTCATCCACGTGAAACCTCGAGGTTTCACGTGGATGAAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-1483s21c1
Sequence:CCGGTTCCTTCCCAGTCATACTTATCTCGAGATAAGTATGACTGGGAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-655s21c1
Sequence:CCGGCCAGCAAGAAAGGTTTAAATTCTCGAGAATTTAAACCTTTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010145.2-263s21c1
Sequence:CCGGGCACCAGAGGATAGATAGGTTCTCGAGAACCTATCTATCCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-800s21c1
Sequence:CCGGCGTGAAAGGTTTGCACTTGAACTCGAGTTCAAGTGCAAACCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-414s1c1
Sequence:CCGGCCACACTTTAAGACCAAGATTCTCGAGAATCTTGGTCTTAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-263s1c1
Sequence:CCGGGCACCAGAGGATAGATAGGTTCTCGAGAACCTATCTATCCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-800s1c1
Sequence:CCGGCGTGAAAGGTTTGCACTTGAACTCGAGTTCAAGTGCAAACCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-1124s1c1
Sequence:CCGGCCTGGAAGATCTGCTGACTAACTCGAGTTAGTCAGCAGATCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-655s1c1
Sequence:CCGGCCAGCAAGAAAGGTTTAAATTCTCGAGAATTTAAACCTTTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010145
VALIDATED
EPHX1 MISSION shRNA Lentiviral Transduction Particles
epoxide hydrolase 1, microsomal (xenobiotic)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-448s21c1
Sequence:CCGGTCCACTTCATCCACGTGAAACCTCGAGGTTTCACGTGGATGAAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-1483s21c1
Sequence:CCGGTTCCTTCCCAGTCATACTTATCTCGAGATAAGTATGACTGGGAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-655s21c1
Sequence:CCGGCCAGCAAGAAAGGTTTAAATTCTCGAGAATTTAAACCTTTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010145.2-263s21c1
Sequence:CCGGGCACCAGAGGATAGATAGGTTCTCGAGAACCTATCTATCCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010145.2-800s21c1
Sequence:CCGGCGTGAAAGGTTTGCACTTGAACTCGAGTTCAAGTGCAAACCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-414s1c1
Sequence:CCGGCCACACTTTAAGACCAAGATTCTCGAGAATCTTGGTCTTAAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-263s1c1
Sequence:CCGGGCACCAGAGGATAGATAGGTTCTCGAGAACCTATCTATCCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-800s1c1
Sequence:CCGGCGTGAAAGGTTTGCACTTGAACTCGAGTTCAAGTGCAAACCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-1124s1c1
Sequence:CCGGCCTGGAAGATCTGCTGACTAACTCGAGTTAGTCAGCAGATCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010145.2-655s1c1
Sequence:CCGGCCAGCAAGAAAGGTTTAAATTCTCGAGAATTTAAACCTTTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000120
VALIDATED
EPHX1 MISSION shRNA Bacterial Glycerol Stock
epoxide hydrolase 1, microsomal (xenobiotic)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-335s1c1
Sequence:CCGGCCGGGACAAAGAGGAAACTTTCTCGAGAAAGTTTCCTCTTTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-1136s1c1
Sequence:CCGGGAAGGTATTCTACAGCCTGATCTCGAGATCAGGCTGTAGAATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-615s1c1
Sequence:CCGGCCTCACTTCAAGACTAAGATTCTCGAGAATCTTAGTCTTGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-1242s1c1
Sequence:CCGGGCCTATATTCTAGAGAAGTTTCTCGAGAAACTTCTCTAGAATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000120.2-566s1c1
Sequence:CCGGGCGGAATGAATTTGACTGGAACTCGAGTTCCAGTCAAATTCATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000120
VALIDATED
EPHX1 MISSION shRNA shRNA Plasmid DNA
epoxide hydrolase 1, microsomal (xenobiotic)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-335s1c1
Sequence:CCGGCCGGGACAAAGAGGAAACTTTCTCGAGAAAGTTTCCTCTTTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-1136s1c1
Sequence:CCGGGAAGGTATTCTACAGCCTGATCTCGAGATCAGGCTGTAGAATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-615s1c1
Sequence:CCGGCCTCACTTCAAGACTAAGATTCTCGAGAATCTTAGTCTTGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-1242s1c1
Sequence:CCGGGCCTATATTCTAGAGAAGTTTCTCGAGAAACTTCTCTAGAATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000120.2-566s1c1
Sequence:CCGGGCGGAATGAATTTGACTGGAACTCGAGTTCCAGTCAAATTCATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000120
VALIDATED
EPHX1 MISSION shRNA Lentiviral Transduction Particles
epoxide hydrolase 1, microsomal (xenobiotic)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-335s1c1
Sequence:CCGGCCGGGACAAAGAGGAAACTTTCTCGAGAAAGTTTCCTCTTTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-1136s1c1
Sequence:CCGGGAAGGTATTCTACAGCCTGATCTCGAGATCAGGCTGTAGAATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-615s1c1
Sequence:CCGGCCTCACTTCAAGACTAAGATTCTCGAGAATCTTAGTCTTGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000120.2-1242s1c1
Sequence:CCGGGCCTATATTCTAGAGAAGTTTCTCGAGAAACTTCTCTAGAATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000120.2-566s1c1
Sequence:CCGGGCGGAATGAATTTGACTGGAACTCGAGTTCCAGTCAAATTCATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks