EMAIL THIS PAGE TO A FRIEND

EPHX2

epoxide hydrolase 2, cytoplasmic

131 Gene Product Result for
Synonyms: CEH SEH
Gene ID:
Human(2053) Summary: This gene encodes a member of the epoxide hydrolase family. The protein, found in both the cytosol and peroxisomes, binds to specific epoxides and converts them to the corresponding dihydrodiols. Mutations in this gene have been associated with familial hypercholesterolemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
Mouse(13850) epoxide hydrolase 2, cytoplasmic
Rat(65030) epoxide hydrolase 2, cytoplasmic
Zebrafish(494099) epoxide hydrolase 2, cytoplasmic
dog(477373) epoxide hydrolase 2, cytoplasmic
cow(511716) epoxide hydrolase 2, cytoplasmic
domestic cat(101092355) epoxide hydrolase 2, cytoplasmic
chicken(421999) epoxide hydrolase 2, cytoplasmic
sheep(101106654) epoxide hydrolase 2, cytoplasmic
Domestic Rabbit(100350230) epoxide hydrolase 2, cytoplasmic
domestic guinea pig(100734490) epoxide hydrolase 2, cytoplasmic
naked mole-rat(101715352) epoxide hydrolase 2, cytoplasmic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
241768 1,1,3,3-Tetramethylguanidine 99% human, mouse pricing
PS61-250MG 1,1-Dimethyl-3-phenylurea analytical standard human, mouse pricing
PS61 1,1-Dimethyl-3-phenylurea analytical standard human, mouse pricing
261394 1,1-Dimethylurea 99% human, mouse pricing
390151 1,3-Bis(4-nitrophenyl)urea 97% human, mouse pricing
131091 1,3-Di-p-tolyl-2-thiourea 97% human, mouse pricing
372889 1,3-Diethyl-1,3-diphenylurea 99% human, mouse pricing
D101087 1,3-Diethylurea 97% human, mouse pricing
D126802 1,3-Diisopropyl-2-thiourea 99% human, mouse pricing
33790 1,3-Diphenyl-2-propanone purum, ≥98.0% (GC) human, mouse pricing
W239704 1,3-Diphenyl-2-propanone ≥98%, FG human, mouse pricing
D204609 1,3-Diphenyl-2-propanone 99% human, mouse pricing
142158 1,3-Diphenylurea 98% human, mouse pricing
C106607 1-Cyclohexyl-3-(2-morpholinoethyl)-2-thiourea 97% human, mouse pricing
426393 1-tert-Butyl-3-ethylcarbodiimide 99% human, mouse pricing
36759 2,2′-Bipyridyl PESTANAL®, analytical standard human, mouse pricing
D216305 2,2′-Bipyridyl ReagentPlus®, ≥99% Green Alternative human, mouse pricing
H19859 2-Hydroxybenzimidazole 97% human, mouse pricing
I601 2-Imidazolidone 96% human, mouse pricing
105937 3,4,4′-Trichlorocarbanilide 99% human, mouse pricing
332992 3-(4-Chlorophenyl)-1,1-dimethylurea 99% human, mouse pricing
245437 α-(Cyanoimino)-3,4-dichlorophenethylamine 99% human, mouse pricing
108227 Benzanilide 98% human, mouse pricing
45363 Butylat PESTANAL®, analytical standard human, mouse pricing
C1290 Chlorpropamide analytical standard, ≥97% human, mouse pricing
379115 DCC 1.0 M in methylene chloride human, mouse pricing
36650 DCC puriss., ≥99.0% (GC) human, mouse pricing
D80002 DCC 99% human, mouse pricing
127221 Di(2-pyridyl) ketone 99% human, mouse pricing
D125407 DIC 99% human, mouse pricing
38370 DIC purum, ≥98.0% (GC) human, mouse pricing
D206539 Diphenyl carbonate ReagentPlus®, 99% human, mouse pricing
278971 Diphenyl N-cyanocarbonimidate 97% human, mouse pricing
D2425 Diuron ≥98% human, mouse pricing
45463 Diuron PESTANAL®, analytical standard human, mouse pricing
45851 Diuron solution 100 μg/mL in acetonitrile, PESTANAL®, analytical standard human, mouse pricing
45469 EPTC PESTANAL®, analytical standard human, mouse pricing
45494 Fenuron PESTANAL®, analytical standard human, mouse pricing
229296 Indigo synthetic, Dye content 95 % human, mouse pricing
36174 Monuron PESTANAL®, analytical standard human, mouse pricing
34640 N,N′-Di-tert-butylcarbodiimide purum, ≥99.0% (GC) human, mouse pricing
235563 N,N′-Di-tert-butylcarbodiimide 99% human, mouse pricing
D49598 N,N′-Dibutylthiourea 97% human, mouse pricing
D80800 N,N′-Dicyclohexylurea 98% human, mouse pricing
D100900 N,N′-Diethylthiourea 98% human, mouse pricing
685666 N,N′-Diisopropylcarbodiimide, ChemDose tablets Loading: 0.15mmol per tablet human, mouse pricing
36574 N,N′-Dimethylurea PESTANAL®, analytical standard human, mouse pricing
40410 N,N′-Dimethylurea (sym.), ≥95.0% (HPLC), technical human, mouse pricing
T28355 N,N′-Diphenylthiourea 98% human, mouse pricing
417629 N,N′-Dipropylurea 97% human, mouse pricing
92468 N,N′-Trimethyleneurea ≥98.0% human, mouse pricing
120685 N-Cyclohexylformamide 99% human, mouse pricing
P7629 N-Phenylthiourea ≥98% human, mouse pricing
P36959 N-Phenylurea 97% human, mouse pricing
36188 Pebulat PESTANAL®, analytical standard human, mouse pricing
440078 Phenyl phenylacetate 96% human, mouse pricing
45641 Propham PESTANAL®, analytical standard human, mouse pricing
34373 Siduron PESTANAL®, analytical standard human, mouse pricing
T24503 Tetramethylurea 99% human, mouse pricing
45687 Thiobencarb PESTANAL®, analytical standard human, mouse pricing
T0891 Tolbutamide analytical standard human, mouse pricing
46968 Tolbutamide VETRANAL, analytical standard human, mouse pricing
43029 1,3-Diphenylguanidine analytical standard (for titrimetry) human, mouse, rat pricing
D207756 1,3-Diphenylguanidine 97% human, mouse, rat pricing
U7129 Urea solution 40 % (w/v) in H2O human, mouse, rat pricing
51457 Urea solution BioUltra, ~8 M in H2O human, mouse, rat pricing
299367 Urea-12C 99.9 atom % 12C human, mouse, rat pricing
T7875 Thiourea ReagentPlus®, ≥99.0% mouse pricing
T8656 Thiourea ACS reagent, ≥99.0% mouse pricing
88810 Thiourea puriss. p.a., ACS reagent, ≥99.0% mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001979 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007940 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007940 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007940 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001979 Rosetta Predictions human pricing
NM_022936 Rosetta Predictions rat pricing
NM_007940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216423 predicted 252
2 SASI_Hs01_00216426 predicted 874
3 SASI_Hs02_00332958 predicted 1057
4 SASI_Hs01_00216427 predicted 1019
5 SASI_Hs01_00216428 predicted 885
6 SASI_Hs01_00216429 predicted 1195
7 SASI_Hs02_00332959 predicted 1445
8 SASI_Hs01_00216431 predicted 230
9 SASI_Hs01_00216432 predicted 1057
10 SASI_Hs02_00332960 predicted 941
11 SASI_Hs01_00216424 predicted 1452
12 SASI_Hs01_00216425 predicted 1016
13 SASI_Hs01_00216430 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051188 predicted 444
2 SASI_Rn01_00051190 predicted 1100
3 SASI_Rn01_00051191 predicted 963
4 SASI_Rn01_00051192 predicted 1366
5 SASI_Rn02_00263642 predicted 664
6 SASI_Rn01_00051193 predicted 1015
7 SASI_Rn01_00051194 predicted 1101
8 SASI_Rn01_00051195 predicted 1657
9 SASI_Rn01_00051196 predicted 935
10 SASI_Rn01_00051197 predicted 887
11 SASI_Rn01_00051189 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076892 predicted 918
2 SASI_Mm02_00312784 predicted 1300
3 SASI_Mm01_00076893 predicted 913
4 SASI_Mm01_00076894 predicted 1652
5 SASI_Mm01_00076895 predicted 417
6 SASI_Mm01_00076897 predicted 337
7 SASI_Mm01_00076898 predicted 1041
8 SASI_Mm01_00076899 predicted 1438
9 SASI_Mm01_00076900 predicted 1767
10 SASI_Mm02_00312785 predicted 1314
11 SASI_Mm01_00076891 predicted 985
12 SASI_Mm01_00076896 predicted 1687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001979
VALIDATED
EPHX2 MISSION shRNA Bacterial Glycerol Stock
epoxide hydrolase 2, cytoplasmic
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-933s1c1
Sequence:CCGGGCTATGGACATGAAAGGCTATCTCGAGATAGCCTTTCATGTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-1662s1c1
Sequence:CCGGGAGGTGAATCAGATCCTCATTCTCGAGAATGAGGATCTGATTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-1435s1c1
Sequence:CCGGCTGGTTTCAGAGGTCCTCTAACTCGAGTTAGAGGACCTCTGAAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001979.3-218s1c1
Sequence:CCGGCCGGCTTATGAAAGGAGAGATCTCGAGATCTCTCCTTTCATAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-333s1c1
Sequence:CCGGGAAATCTTTGACAAGGCGATTCTCGAGAATCGCCTTGTCAAAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-1276s21c1
Sequence:CCGGCAGAACCTGAGTCGGACTTTCCTCGAGGAAAGTCCGACTCAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-542s21c1
Sequence:CCGGGTCAGGTGGGAATGGTCAAACCTCGAGGTTTGACCATTCCCACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-795s21c1
Sequence:CCGGCCATGGGTACGTGACAGTAAACTCGAGTTTACTGTCACGTACCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-1002s21c1
Sequence:CCGGATATTGCATGGAAGTGTTATGCTCGAGCATAACACTTCCATGCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001979.4-1800s21c1
Sequence:CCGGGGGCACCATTCTTAGTATACACTCGAGTGTATACTAAGAATGGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001979.4-1966s21c1
Sequence:CCGGATGAATGCATCGTCCCTTTATCTCGAGATAAAGGGACGATGCATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-975s21c1
Sequence:CCGGGTCATCTGCTCCTCCCGAAATCTCGAGATTTCGGGAGGAGCAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001979
VALIDATED
EPHX2 MISSION shRNA shRNA Plasmid DNA
epoxide hydrolase 2, cytoplasmic
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-933s1c1
Sequence:CCGGGCTATGGACATGAAAGGCTATCTCGAGATAGCCTTTCATGTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-1662s1c1
Sequence:CCGGGAGGTGAATCAGATCCTCATTCTCGAGAATGAGGATCTGATTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-1435s1c1
Sequence:CCGGCTGGTTTCAGAGGTCCTCTAACTCGAGTTAGAGGACCTCTGAAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001979.3-218s1c1
Sequence:CCGGCCGGCTTATGAAAGGAGAGATCTCGAGATCTCTCCTTTCATAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-333s1c1
Sequence:CCGGGAAATCTTTGACAAGGCGATTCTCGAGAATCGCCTTGTCAAAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-1276s21c1
Sequence:CCGGCAGAACCTGAGTCGGACTTTCCTCGAGGAAAGTCCGACTCAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-542s21c1
Sequence:CCGGGTCAGGTGGGAATGGTCAAACCTCGAGGTTTGACCATTCCCACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-795s21c1
Sequence:CCGGCCATGGGTACGTGACAGTAAACTCGAGTTTACTGTCACGTACCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-1002s21c1
Sequence:CCGGATATTGCATGGAAGTGTTATGCTCGAGCATAACACTTCCATGCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001979.4-1800s21c1
Sequence:CCGGGGGCACCATTCTTAGTATACACTCGAGTGTATACTAAGAATGGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001979.4-1966s21c1
Sequence:CCGGATGAATGCATCGTCCCTTTATCTCGAGATAAAGGGACGATGCATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-975s21c1
Sequence:CCGGGTCATCTGCTCCTCCCGAAATCTCGAGATTTCGGGAGGAGCAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001979
VALIDATED
EPHX2 MISSION shRNA Lentiviral Transduction Particles
epoxide hydrolase 2, cytoplasmic
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-933s1c1
Sequence:CCGGGCTATGGACATGAAAGGCTATCTCGAGATAGCCTTTCATGTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-1662s1c1
Sequence:CCGGGAGGTGAATCAGATCCTCATTCTCGAGAATGAGGATCTGATTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-1435s1c1
Sequence:CCGGCTGGTTTCAGAGGTCCTCTAACTCGAGTTAGAGGACCTCTGAAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001979.3-218s1c1
Sequence:CCGGCCGGCTTATGAAAGGAGAGATCTCGAGATCTCTCCTTTCATAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001979.3-333s1c1
Sequence:CCGGGAAATCTTTGACAAGGCGATTCTCGAGAATCGCCTTGTCAAAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-1276s21c1
Sequence:CCGGCAGAACCTGAGTCGGACTTTCCTCGAGGAAAGTCCGACTCAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-542s21c1
Sequence:CCGGGTCAGGTGGGAATGGTCAAACCTCGAGGTTTGACCATTCCCACCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-795s21c1
Sequence:CCGGCCATGGGTACGTGACAGTAAACTCGAGTTTACTGTCACGTACCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-1002s21c1
Sequence:CCGGATATTGCATGGAAGTGTTATGCTCGAGCATAACACTTCCATGCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001979.4-1800s21c1
Sequence:CCGGGGGCACCATTCTTAGTATACACTCGAGTGTATACTAAGAATGGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001979.4-1966s21c1
Sequence:CCGGATGAATGCATCGTCCCTTTATCTCGAGATAAAGGGACGATGCATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001979.4-975s21c1
Sequence:CCGGGTCATCTGCTCCTCCCGAAATCTCGAGATTTCGGGAGGAGCAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007940
VALIDATED
EPHX2 MISSION shRNA Bacterial Glycerol Stock
epoxide hydrolase 2, cytoplasmic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-1557s1c1
Sequence:CCGGCCGTCCTGAAATGTCCAAGAACTCGAGTTCTTGGACATTTCAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-1312s1c1
Sequence:CCGGGCTGTGCATAAAGCCACTGAACTCGAGTTCAGTGGCTTTATGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-496s1c1
Sequence:CCGGCAACACTTTGACTTCCTGATACTCGAGTATCAGGAAGTCAAAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007940.2-299s1c1
Sequence:CCGGGAGCCAATCTACCTGAGAATTCTCGAGAATTCTCAGGTAGATTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-1169s1c1
Sequence:CCGGCCATGAAAGTTATCCGATCTACTCGAGTAGATCGGATAACTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007940
VALIDATED
EPHX2 MISSION shRNA shRNA Plasmid DNA
epoxide hydrolase 2, cytoplasmic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-1557s1c1
Sequence:CCGGCCGTCCTGAAATGTCCAAGAACTCGAGTTCTTGGACATTTCAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-1312s1c1
Sequence:CCGGGCTGTGCATAAAGCCACTGAACTCGAGTTCAGTGGCTTTATGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-496s1c1
Sequence:CCGGCAACACTTTGACTTCCTGATACTCGAGTATCAGGAAGTCAAAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007940.2-299s1c1
Sequence:CCGGGAGCCAATCTACCTGAGAATTCTCGAGAATTCTCAGGTAGATTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-1169s1c1
Sequence:CCGGCCATGAAAGTTATCCGATCTACTCGAGTAGATCGGATAACTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007940
VALIDATED
EPHX2 MISSION shRNA Lentiviral Transduction Particles
epoxide hydrolase 2, cytoplasmic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-1557s1c1
Sequence:CCGGCCGTCCTGAAATGTCCAAGAACTCGAGTTCTTGGACATTTCAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-1312s1c1
Sequence:CCGGGCTGTGCATAAAGCCACTGAACTCGAGTTCAGTGGCTTTATGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-496s1c1
Sequence:CCGGCAACACTTTGACTTCCTGATACTCGAGTATCAGGAAGTCAAAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007940.2-299s1c1
Sequence:CCGGGAGCCAATCTACCTGAGAATTCTCGAGAATTCTCAGGTAGATTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007940.2-1169s1c1
Sequence:CCGGCCATGAAAGTTATCCGATCTACTCGAGTAGATCGGATAACTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks