EMAIL THIS PAGE TO A FRIEND

EPHX3

epoxide hydrolase 3

46 Gene Product Result for
Synonyms: ABHD9
UniProtKB ID: Q9H6B9, A3KMR3
Gene ID:
Mouse(71932) epoxide hydrolase 3
Rat(366836) epoxide hydrolase 3
naked mole-rat(101722570) epoxide hydrolase 3
domestic guinea pig(100732055) epoxide hydrolase 3
sheep(101120077) epoxide hydrolase 3
cow(617882) epoxide hydrolase 3
domestic cat(101099782) epoxide hydrolase 3
dog(100684177) epoxide hydrolase 3
dog(610434) epoxide hydrolase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024794 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005011 MISSION® esiRNA esiRNA targeting human ABHD9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024794 Rosetta Predictions human pricing
NM_001108988 Rosetta Predictions rat pricing
NM_001033163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088844 predicted 1247
2 SASI_Hs01_00088845 predicted 1526
3 SASI_Hs01_00088846 predicted 1328
4 SASI_Hs01_00088847 predicted 428
5 SASI_Hs01_00088848 predicted 540
6 SASI_Hs01_00088849 predicted 1381
7 SASI_Hs01_00088850 predicted 739
8 SASI_Hs01_00088851 predicted 685
9 SASI_Hs01_00088852 predicted 616
10 SASI_Hs01_00088853 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244064 predicted 821
2 SASI_Rn02_00244065 predicted 809
3 SASI_Rn02_00244066 predicted 525
4 SASI_Rn02_00244067 predicted 1013
5 SASI_Rn02_00244068 predicted 748
6 SASI_Rn02_00244069 predicted 837
7 SASI_Rn02_00244070 predicted 546
8 SASI_Rn02_00244071 predicted 601
9 SASI_Rn02_00244072 predicted 1287
10 SASI_Rn02_00244073 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135021 predicted 979
2 SASI_Mm01_00135022 predicted 470
3 SASI_Mm01_00135023 predicted 886
4 SASI_Mm02_00288242 predicted 645
5 SASI_Mm01_00135024 predicted 1243
6 SASI_Mm01_00135025 predicted 640
7 SASI_Mm01_00135026 predicted 828
8 SASI_Mm01_00135027 predicted 794
9 SASI_Mm01_00135029 predicted 496
10 SASI_Mm02_00288243 predicted 568
11 SASI_Mm01_00135020 predicted 856
12 SASI_Mm01_00135028 predicted 925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024794
EPHX3 MISSION shRNA Bacterial Glycerol Stock
epoxide hydrolase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024794.2-1638s21c1
Sequence:CCGGCATAGCTGCACAGACCTTAAACTCGAGTTTAAGGTCTGTGCAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024794.2-812s21c1
Sequence:CCGGGTCGGTGTACCAAGACTATTCCTCGAGGAATAGTCTTGGTACACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024794.2-1394s21c1
Sequence:CCGGGAACTCTTGAATCGCTCATAGCTCGAGCTATGAGCGATTCAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-1052s1c1
Sequence:CCGGCCGAAACCTCTTCAGGAACTTCTCGAGAAGTTCCTGAAGAGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-591s1c1
Sequence:CCGGGCTGTGGACTTGCGAGGCTATCTCGAGATAGCCTCGCAAGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-908s1c1
Sequence:CCGGGCTGTCTATGTCTGACTTTCACTCGAGTGAAAGTCAGACATAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-836s1c1
Sequence:CCGGGCACCACATCAGCCAGTTCTTCTCGAGAAGAACTGGCTGATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-692s1c1
Sequence:CCGGCCTGGGTTACTCGAAGTGCATCTCGAGATGCACTTCGAGTAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024794
EPHX3 MISSION shRNA shRNA Plasmid DNA
epoxide hydrolase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024794.2-1638s21c1
Sequence:CCGGCATAGCTGCACAGACCTTAAACTCGAGTTTAAGGTCTGTGCAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024794.2-812s21c1
Sequence:CCGGGTCGGTGTACCAAGACTATTCCTCGAGGAATAGTCTTGGTACACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024794.2-1394s21c1
Sequence:CCGGGAACTCTTGAATCGCTCATAGCTCGAGCTATGAGCGATTCAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-1052s1c1
Sequence:CCGGCCGAAACCTCTTCAGGAACTTCTCGAGAAGTTCCTGAAGAGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-591s1c1
Sequence:CCGGGCTGTGGACTTGCGAGGCTATCTCGAGATAGCCTCGCAAGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-908s1c1
Sequence:CCGGGCTGTCTATGTCTGACTTTCACTCGAGTGAAAGTCAGACATAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-836s1c1
Sequence:CCGGGCACCACATCAGCCAGTTCTTCTCGAGAAGAACTGGCTGATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-692s1c1
Sequence:CCGGCCTGGGTTACTCGAAGTGCATCTCGAGATGCACTTCGAGTAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024794
EPHX3 MISSION shRNA Lentiviral Transduction Particles
epoxide hydrolase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024794.2-1638s21c1
Sequence:CCGGCATAGCTGCACAGACCTTAAACTCGAGTTTAAGGTCTGTGCAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024794.2-812s21c1
Sequence:CCGGGTCGGTGTACCAAGACTATTCCTCGAGGAATAGTCTTGGTACACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024794.2-1394s21c1
Sequence:CCGGGAACTCTTGAATCGCTCATAGCTCGAGCTATGAGCGATTCAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-1052s1c1
Sequence:CCGGCCGAAACCTCTTCAGGAACTTCTCGAGAAGTTCCTGAAGAGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-591s1c1
Sequence:CCGGGCTGTGGACTTGCGAGGCTATCTCGAGATAGCCTCGCAAGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-908s1c1
Sequence:CCGGGCTGTCTATGTCTGACTTTCACTCGAGTGAAAGTCAGACATAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-836s1c1
Sequence:CCGGGCACCACATCAGCCAGTTCTTCTCGAGAAGAACTGGCTGATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024794.1-692s1c1
Sequence:CCGGCCTGGGTTACTCGAAGTGCATCTCGAGATGCACTTCGAGTAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033163
EPHX3 MISSION shRNA Bacterial Glycerol Stock
epoxide hydrolase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-589s21c1
Sequence:CCGGGCTGTAGACATGCGTGGTTATCTCGAGATAACCACGCATGTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033163.3-1442s21c1
Sequence:CCGGCGTGGATGTCTTACTACTTATCTCGAGATAAGTAGTAAGACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-844s21c1
Sequence:CCGGGGCCAGATATTCCGATCAAACCTCGAGGTTTGATCGGAATATCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-179s21c1
Sequence:CCGGGCAAGGATATGCCGGAGTTTGCTCGAGCAAACTCCGGCATATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-1181s21c1
Sequence:CCGGGCCGGTTGGAAAGCCACATTTCTCGAGAAATGTGGCTTTCCAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033163
EPHX3 MISSION shRNA shRNA Plasmid DNA
epoxide hydrolase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-589s21c1
Sequence:CCGGGCTGTAGACATGCGTGGTTATCTCGAGATAACCACGCATGTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033163.3-1442s21c1
Sequence:CCGGCGTGGATGTCTTACTACTTATCTCGAGATAAGTAGTAAGACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-844s21c1
Sequence:CCGGGGCCAGATATTCCGATCAAACCTCGAGGTTTGATCGGAATATCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-179s21c1
Sequence:CCGGGCAAGGATATGCCGGAGTTTGCTCGAGCAAACTCCGGCATATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-1181s21c1
Sequence:CCGGGCCGGTTGGAAAGCCACATTTCTCGAGAAATGTGGCTTTCCAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033163
EPHX3 MISSION shRNA Lentiviral Transduction Particles
epoxide hydrolase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-589s21c1
Sequence:CCGGGCTGTAGACATGCGTGGTTATCTCGAGATAACCACGCATGTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033163.3-1442s21c1
Sequence:CCGGCGTGGATGTCTTACTACTTATCTCGAGATAAGTAGTAAGACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-844s21c1
Sequence:CCGGGGCCAGATATTCCGATCAAACCTCGAGGTTTGATCGGAATATCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-179s21c1
Sequence:CCGGGCAAGGATATGCCGGAGTTTGCTCGAGCAAACTCCGGCATATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033163.3-1181s21c1
Sequence:CCGGGCCGGTTGGAAAGCCACATTTCTCGAGAAATGTGGCTTTCCAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks