EMAIL THIS PAGE TO A FRIEND

EPHX4

epoxide hydrolase 4

67 Gene Product Result for
Synonyms: ABHD7 EPHXRP
UniProtKB ID: Q8IUS5, Q8NCC6
Gene ID:
Mouse(384214) epoxide hydrolase 4
Rat(289440) epoxide hydrolase 4
Zebrafish(100331939) epoxide hydrolase 4
cow(524246) epoxide hydrolase 4
domestic cat(101096907) epoxide hydrolase 4
dog(490160) epoxide hydrolase 4
chicken(424505) epoxide hydrolase 4
sheep(101102684) epoxide hydrolase 4
domestic guinea pig(100716598) epoxide hydrolase 4
naked mole-rat(101719200) epoxide hydrolase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173567 Rosetta Predictions human pricing
NM_001105994 Rosetta Predictions rat pricing
NM_001001804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191606 predicted 986
2 SASI_Hs02_00368396 predicted 402
3 SASI_Hs01_00191607 predicted 490
4 SASI_Hs01_00191610 predicted 296
5 SASI_Hs01_00191611 predicted 596
6 SASI_Hs01_00191612 predicted 898
7 SASI_Hs01_00191613 predicted 450
8 SASI_Hs01_00191614 predicted 840
9 SASI_Hs01_00191615 predicted 392
10 SASI_Hs02_00368397 predicted 889
11 SASI_Hs01_00191608 predicted 1193
12 SASI_Hs01_00191609 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214582 predicted 872
2 SASI_Rn02_00214583 predicted 736
3 SASI_Rn02_00214584 predicted 903
4 SASI_Rn02_00214585 predicted 777
5 SASI_Rn02_00214586 predicted 540
6 SASI_Rn02_00214587 predicted 673
7 SASI_Rn02_00214588 predicted 355
8 SASI_Rn02_00214589 predicted 772
9 SASI_Rn02_00214590 predicted 546
10 SASI_Rn02_00214591 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170063 predicted 357
2 SASI_Mm01_00170064 predicted 801
3 SASI_Mm01_00170065 predicted 859
4 SASI_Mm01_00170068 predicted 748
5 SASI_Mm01_00170067 predicted 354
6 SASI_Mm02_00286210 predicted 736
7 SASI_Mm01_00170069 predicted 401
8 SASI_Mm02_00286211 predicted 342
9 SASI_Mm01_00170070 predicted 438
10 SASI_Mm01_00170071 predicted 841
11 SASI_Mm01_00170066 predicted 587
12 SASI_Mm01_00170072 predicted 708
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173567
EPHX4 MISSION shRNA Bacterial Glycerol Stock
epoxide hydrolase 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-906s1c1
Sequence:CCGGGCCCAATTAACCATTACCGAACTCGAGTTCGGTAATGGTTAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-449s1c1
Sequence:CCGGGCACTGGATTTGAGAGGTTATCTCGAGATAACCTCTCAAATCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-302s1c1
Sequence:CCGGCGGATCAAGGATTCAGGGTTACTCGAGTAACCCTGAATCCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-482s1c1
Sequence:CCGGGCTCCCATTCATCGACAGAATCTCGAGATTCTGTCGATGAATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-709s1c1
Sequence:CCGGGCTGTTGAAATCCAGTTATTACTCGAGTAATAACTGGATTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-482s1c2
Sequence:CCGGGCTCCCATTCATCGACAGAATCTCGAGATTCTGTCGATGAATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-654s21c1
Sequence:CCGGGAAATGGTGATGAAGCTTATTCTCGAGAATAAGCTTCATCACCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-619s21c1
Sequence:CCGGGCATGATTGCTTGGCTAATTGCTCGAGCAATTAGCCAAGCAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-878s21c1
Sequence:CCGGAGAGGATCTTGAAGCTTATATCTCGAGATATAAGCTTCAAGATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-1046s21c1
Sequence:CCGGGGCTGAAGTCACAAAGATTTACTCGAGTAAATCTTTGTGACTTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-566s21c1
Sequence:CCGGTTTAGATTCTTTAGGGTATAGCTCGAGCTATACCCTAAAGAATCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173567
EPHX4 MISSION shRNA shRNA Plasmid DNA
epoxide hydrolase 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-906s1c1
Sequence:CCGGGCCCAATTAACCATTACCGAACTCGAGTTCGGTAATGGTTAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-449s1c1
Sequence:CCGGGCACTGGATTTGAGAGGTTATCTCGAGATAACCTCTCAAATCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-302s1c1
Sequence:CCGGCGGATCAAGGATTCAGGGTTACTCGAGTAACCCTGAATCCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-482s1c1
Sequence:CCGGGCTCCCATTCATCGACAGAATCTCGAGATTCTGTCGATGAATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-709s1c1
Sequence:CCGGGCTGTTGAAATCCAGTTATTACTCGAGTAATAACTGGATTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-482s1c2
Sequence:CCGGGCTCCCATTCATCGACAGAATCTCGAGATTCTGTCGATGAATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-654s21c1
Sequence:CCGGGAAATGGTGATGAAGCTTATTCTCGAGAATAAGCTTCATCACCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-619s21c1
Sequence:CCGGGCATGATTGCTTGGCTAATTGCTCGAGCAATTAGCCAAGCAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-878s21c1
Sequence:CCGGAGAGGATCTTGAAGCTTATATCTCGAGATATAAGCTTCAAGATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-1046s21c1
Sequence:CCGGGGCTGAAGTCACAAAGATTTACTCGAGTAAATCTTTGTGACTTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-566s21c1
Sequence:CCGGTTTAGATTCTTTAGGGTATAGCTCGAGCTATACCCTAAAGAATCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173567
EPHX4 MISSION shRNA Lentiviral Transduction Particles
epoxide hydrolase 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-906s1c1
Sequence:CCGGGCCCAATTAACCATTACCGAACTCGAGTTCGGTAATGGTTAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-449s1c1
Sequence:CCGGGCACTGGATTTGAGAGGTTATCTCGAGATAACCTCTCAAATCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-302s1c1
Sequence:CCGGCGGATCAAGGATTCAGGGTTACTCGAGTAACCCTGAATCCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-482s1c1
Sequence:CCGGGCTCCCATTCATCGACAGAATCTCGAGATTCTGTCGATGAATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-709s1c1
Sequence:CCGGGCTGTTGAAATCCAGTTATTACTCGAGTAATAACTGGATTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173567.2-482s1c2
Sequence:CCGGGCTCCCATTCATCGACAGAATCTCGAGATTCTGTCGATGAATGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-654s21c1
Sequence:CCGGGAAATGGTGATGAAGCTTATTCTCGAGAATAAGCTTCATCACCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-619s21c1
Sequence:CCGGGCATGATTGCTTGGCTAATTGCTCGAGCAATTAGCCAAGCAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-878s21c1
Sequence:CCGGAGAGGATCTTGAAGCTTATATCTCGAGATATAAGCTTCAAGATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-1046s21c1
Sequence:CCGGGGCTGAAGTCACAAAGATTTACTCGAGTAAATCTTTGTGACTTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173567.4-566s21c1
Sequence:CCGGTTTAGATTCTTTAGGGTATAGCTCGAGCTATACCCTAAAGAATCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001804
EPHX4 MISSION shRNA Bacterial Glycerol Stock
epoxide hydrolase 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000101730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-855s1c1
Sequence:CCGGCCTGCCTCTCAAACATCACATCTCGAGATGTGATGTTTGAGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-288s1c1
Sequence:CCGGGCTTCATGGATTTCCAGAATTCTCGAGAATTCTGGAAATCCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-910s1c1
Sequence:CCGGGAAGATGCGTTTATGGAGGTACTCGAGTACCTCCATAAACGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-403s1c1
Sequence:CCGGGCTCATCAAGAGAGTTACAAACTCGAGTTTGTAACTCTCTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001804
EPHX4 MISSION shRNA shRNA Plasmid DNA
epoxide hydrolase 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000101730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-855s1c1
Sequence:CCGGCCTGCCTCTCAAACATCACATCTCGAGATGTGATGTTTGAGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-288s1c1
Sequence:CCGGGCTTCATGGATTTCCAGAATTCTCGAGAATTCTGGAAATCCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-910s1c1
Sequence:CCGGGAAGATGCGTTTATGGAGGTACTCGAGTACCTCCATAAACGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-403s1c1
Sequence:CCGGGCTCATCAAGAGAGTTACAAACTCGAGTTTGTAACTCTCTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001804
EPHX4 MISSION shRNA Lentiviral Transduction Particles
epoxide hydrolase 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000101730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-855s1c1
Sequence:CCGGCCTGCCTCTCAAACATCACATCTCGAGATGTGATGTTTGAGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-288s1c1
Sequence:CCGGGCTTCATGGATTTCCAGAATTCTCGAGAATTCTGGAAATCCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-910s1c1
Sequence:CCGGGAAGATGCGTTTATGGAGGTACTCGAGTACCTCCATAAACGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001804.1-403s1c1
Sequence:CCGGGCTCATCAAGAGAGTTACAAACTCGAGTTTGTAACTCTCTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks