EMAIL THIS PAGE TO A FRIEND

EPM2A

epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)

Synonyms: EPM2 MELF
UniProtKB ID: B3EWF7
Gene ID:
Human(7957) Summary: This gene encodes a dual-specificity phosphatase that associates with polyribosomes. The encoded protein may be involved in the regulation of glycogen metabolism. Mutations in this gene have been associated with myoclonic epilepsy of Lafora. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(13853) epilepsy, progressive myoclonic epilepsy, type 2 gene alpha
Rat(114005) epilepsy, progressive myoclonus type 2A
Zebrafish(100535304) epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
domestic cat(101096812) epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
cow(526888) epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
chicken(421611) epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
dog(484022) epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
sheep(101102494) epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
naked mole-rat(101709129) epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
domestic guinea pig(100731363) epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E0158 Anti-EPM2A (91-105) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA053643 Anti-EPM2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA055468 Anti-EPM2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1411434 Anti-EPM2A antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2500581 Anti-Laforin (Isoform A) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, bovine, rat, canine, human
ELISA, immunohistochemistry, western blot pricing
WH0007957M2 Monoclonal Anti-EPM2A antibody produced in mouse clone 6C6, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB1404563 Monoclonal Anti-EPM2A antibody produced in mouse clone 4A12, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB5201527 Monoclonal Anti-Laforin - Alkaline Phosphatase antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201528 Monoclonal Anti-Laforin - Apc antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201519 Monoclonal Anti-Laforin - Atto 390 antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201520 Monoclonal Anti-Laforin - Atto 488 antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201521 Monoclonal Anti-Laforin - Atto 565 antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201522 Monoclonal Anti-Laforin - Atto 594 antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201523 Monoclonal Anti-Laforin - Atto 633 antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201524 Monoclonal Anti-Laforin - Atto 655 antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201525 Monoclonal Anti-Laforin - Atto 680 antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201526 Monoclonal Anti-Laforin - Atto 700 antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201529 Monoclonal Anti-Laforin - Biotin antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201530 Monoclonal Anti-Laforin - Fitc antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201531 Monoclonal Anti-Laforin - Hrp antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201532 Monoclonal Anti-Laforin - Pe/Atto 594 antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201533 Monoclonal Anti-Laforin - Percp antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201534 Monoclonal Anti-Laforin - Rpe antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201535 Monoclonal Anti-Laforin - Streptavidin antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201518 Monoclonal Anti-Laforin antibody produced in mouse clone S84-37, purified immunoglobulin human
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005670 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018041 Rosetta Predictions human pricing
NM_005670 Rosetta Predictions human pricing
NM_010146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081809 predicted 593
2 SASI_Hs01_00081810 predicted 864
3 SASI_Hs01_00081811 predicted 870
4 SASI_Hs01_00081812 predicted 668
5 SASI_Hs02_00306934 predicted 988
6 SASI_Hs01_00081813 predicted 986
7 SASI_Hs01_00081815 predicted 992
8 SASI_Hs01_00081816 predicted 993
9 SASI_Hs01_00081817 predicted 812
10 SASI_Hs01_00081818 predicted 700
11 SASI_Hs01_00081814 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137101 predicted 599
2 SASI_Hs01_00137102 predicted 859
3 SASI_Hs01_00137103 predicted 875
4 SASI_Hs01_00137104 predicted 667
5 SASI_Hs02_00340056 predicted 989
6 SASI_Hs01_00137105 predicted 984
7 SASI_Hs01_00137107 predicted 984
8 SASI_Hs01_00137108 predicted 993
9 SASI_Hs01_00137109 predicted 818
10 SASI_Hs01_00137110 predicted 705
11 SASI_Hs01_00137106 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317889 predicted 475
2 SASI_Mm02_00317890 predicted 328
3 SASI_Mm01_00110321 predicted 545
4 SASI_Mm02_00317891 predicted 385
5 SASI_Mm01_00110323 predicted 345
6 SASI_Mm01_00110324 predicted 565
7 SASI_Mm02_00317892 predicted 262
8 SASI_Mm02_00317893 predicted 574
9 SASI_Mm02_00317894 predicted 664
10 SASI_Mm01_00110325 predicted 505
11 SASI_Mm01_00110317 predicted 411
12 SASI_Mm01_00110318 predicted 1165
13 SASI_Mm01_00110319 predicted 1033
14 SASI_Mm01_00110320 predicted 618
15 SASI_Mm01_00110322 predicted 706
16 SASI_Mm01_00110326 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005670
VALIDATED
EPM2A MISSION shRNA Bacterial Glycerol Stock
epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-677s21c1
Sequence:CCGGACCGTTGCTGTACTTACAATGCTCGAGCATTGTAAGTACAGCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-932s21c1
Sequence:CCGGTCCAGACTGAATGGGATATTGCTCGAGCAATATCCCATTCAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005670.3-3156s21c1
Sequence:GTACCGGTGGTATTCAGGTAACTCATTTCTCGAGAAATGAGTTACCTGAATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-867s21c1
Sequence:CCGGTCGTCAGGTGGAACATGTAACCTCGAGGTTACATGTTCCACCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-809s21c1
Sequence:CCGGGCCACCAAGCCATGCATTATTCTCGAGAATAATGCATGGCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-761s1c1
Sequence:CCGGACACCAATGAAATGAAGCACACTCGAGTGTGCTTCATTTCATTGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005670.x-809s1c1
Sequence:CCGGGCCACCAAGCCATGCATTATTCTCGAGAATAATGCATGGCTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-704s1c1
Sequence:CCGGACTTGGTGGATGGTGTGTATTCTCGAGAATACACACCATCCACCAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-1815s1c1
Sequence:CCGGTAGAAGCCTGAACCGTACAAACTCGAGTTTGTACGGTTCAGGCTTCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-605s1c1
Sequence:CCGGCGTTCTGGTACAAGTTCCTGACTCGAGTCAGGAACTTGTACCAGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005670
VALIDATED
EPM2A MISSION shRNA shRNA Plasmid DNA
epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-677s21c1
Sequence:CCGGACCGTTGCTGTACTTACAATGCTCGAGCATTGTAAGTACAGCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-932s21c1
Sequence:CCGGTCCAGACTGAATGGGATATTGCTCGAGCAATATCCCATTCAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005670.3-3156s21c1
Sequence:GTACCGGTGGTATTCAGGTAACTCATTTCTCGAGAAATGAGTTACCTGAATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-867s21c1
Sequence:CCGGTCGTCAGGTGGAACATGTAACCTCGAGGTTACATGTTCCACCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-809s21c1
Sequence:CCGGGCCACCAAGCCATGCATTATTCTCGAGAATAATGCATGGCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-761s1c1
Sequence:CCGGACACCAATGAAATGAAGCACACTCGAGTGTGCTTCATTTCATTGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005670.x-809s1c1
Sequence:CCGGGCCACCAAGCCATGCATTATTCTCGAGAATAATGCATGGCTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-704s1c1
Sequence:CCGGACTTGGTGGATGGTGTGTATTCTCGAGAATACACACCATCCACCAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-1815s1c1
Sequence:CCGGTAGAAGCCTGAACCGTACAAACTCGAGTTTGTACGGTTCAGGCTTCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-605s1c1
Sequence:CCGGCGTTCTGGTACAAGTTCCTGACTCGAGTCAGGAACTTGTACCAGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005670
VALIDATED
EPM2A MISSION shRNA Lentiviral Transduction Particles
epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-677s21c1
Sequence:CCGGACCGTTGCTGTACTTACAATGCTCGAGCATTGTAAGTACAGCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-932s21c1
Sequence:CCGGTCCAGACTGAATGGGATATTGCTCGAGCAATATCCCATTCAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005670.3-3156s21c1
Sequence:GTACCGGTGGTATTCAGGTAACTCATTTCTCGAGAAATGAGTTACCTGAATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-867s21c1
Sequence:CCGGTCGTCAGGTGGAACATGTAACCTCGAGGTTACATGTTCCACCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005670.3-809s21c1
Sequence:CCGGGCCACCAAGCCATGCATTATTCTCGAGAATAATGCATGGCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-761s1c1
Sequence:CCGGACACCAATGAAATGAAGCACACTCGAGTGTGCTTCATTTCATTGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005670.x-809s1c1
Sequence:CCGGGCCACCAAGCCATGCATTATTCTCGAGAATAATGCATGGCTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-704s1c1
Sequence:CCGGACTTGGTGGATGGTGTGTATTCTCGAGAATACACACCATCCACCAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-1815s1c1
Sequence:CCGGTAGAAGCCTGAACCGTACAAACTCGAGTTTGTACGGTTCAGGCTTCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005670.x-605s1c1
Sequence:CCGGCGTTCTGGTACAAGTTCCTGACTCGAGTCAGGAACTTGTACCAGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010146
EPM2A MISSION shRNA Bacterial Glycerol Stock
epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010146.1-1190s1c1
Sequence:CCGGGCTTGTGTTTGAAATGCTTTACTCGAGTAAAGCATTTCAAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-392s1c1
Sequence:CCGGGCACATATAATGAGGACAACTCTCGAGAGTTGTCCTCATTATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-483s1c1
Sequence:CCGGGCGCACAACAGACTTCTATTTCTCGAGAAATAGAAGTCTGTTGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-994s1c1
Sequence:CCGGGCTCAAGCACAACAAGACTTTCTCGAGAAAGTCTTGTTGTGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-906s1c1
Sequence:CCGGCCACTATGTGATTGGCTGGAACTCGAGTTCCAGCCAATCACATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010146
EPM2A MISSION shRNA shRNA Plasmid DNA
epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010146.1-1190s1c1
Sequence:CCGGGCTTGTGTTTGAAATGCTTTACTCGAGTAAAGCATTTCAAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-392s1c1
Sequence:CCGGGCACATATAATGAGGACAACTCTCGAGAGTTGTCCTCATTATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-483s1c1
Sequence:CCGGGCGCACAACAGACTTCTATTTCTCGAGAAATAGAAGTCTGTTGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-994s1c1
Sequence:CCGGGCTCAAGCACAACAAGACTTTCTCGAGAAAGTCTTGTTGTGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-906s1c1
Sequence:CCGGCCACTATGTGATTGGCTGGAACTCGAGTTCCAGCCAATCACATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010146
EPM2A MISSION shRNA Lentiviral Transduction Particles
epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010146.1-1190s1c1
Sequence:CCGGGCTTGTGTTTGAAATGCTTTACTCGAGTAAAGCATTTCAAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-392s1c1
Sequence:CCGGGCACATATAATGAGGACAACTCTCGAGAGTTGTCCTCATTATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-483s1c1
Sequence:CCGGGCGCACAACAGACTTCTATTTCTCGAGAAATAGAAGTCTGTTGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-994s1c1
Sequence:CCGGGCTCAAGCACAACAAGACTTTCTCGAGAAAGTCTTGTTGTGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010146.1-906s1c1
Sequence:CCGGCCACTATGTGATTGGCTGGAACTCGAGTTCCAGCCAATCACATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks