EMAIL THIS PAGE TO A FRIEND

EPM2AIP1

EPM2A (laforin) interacting protein 1

217 Gene Product Result for
UniProtKB ID: Q7L775, O94866, Q9H3L3
Gene ID:
Human(9852) Summary: The EPM2A gene, which encodes laforin, is mutated in an autosomal recessive form of adolescent progressive myoclonus epilepsy. The protein encoded by this gene binds to laforin, but its function is not known. This gene is intronless. [provided by RefSeq, Oct 2008]
Mouse(77781) EPM2A (laforin) interacting protein 1
Rat(316021) EPM2A (laforin) interacting protein 1
domestic guinea pig(100718130) EPM2A (laforin) interacting protein 1
naked mole-rat(101697778) EPM2A (laforin) interacting protein 1
sheep(101109125) EPM2A (laforin) interacting protein 1
Horse(100050426) EPM2A (laforin) interacting protein 1
dog(608901) EPM2A (laforin) interacting protein 1
cow(540067) EPM2A (laforin) interacting protein 1
domestic cat(101089795) EPM2A (laforin) interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014805 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014805 Rosetta Predictions human pricing
XM_001076356 Rosetta Predictions rat pricing
XM_236659 Rosetta Predictions rat pricing
NM_175266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204748 predicted 970
2 SASI_Hs01_00204750 predicted 654
3 SASI_Hs01_00204751 predicted 1705
4 SASI_Hs02_00346323 predicted 1966
5 SASI_Hs01_00204752 predicted 975
6 SASI_Hs01_00204753 predicted 1926
7 SASI_Hs01_00204754 predicted 403
8 SASI_Hs02_00346324 predicted 1165
9 SASI_Hs01_00204755 predicted 1218
10 SASI_Hs01_00204756 predicted 1456
11 SASI_Hs01_00204749 predicted 1467
12 SASI_Hs01_00204757 predicted 1598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352991 predicted 937
2 SASI_Rn02_00352992 predicted 1937
3 SASI_Rn02_00352993 predicted 1624
4 SASI_Rn02_00352994 predicted 1118
5 SASI_Rn02_00352995 predicted 1868
6 SASI_Rn02_00352996 predicted 1723
7 SASI_Rn02_00352997 predicted 1754
8 SASI_Rn02_00352998 predicted 641
9 SASI_Rn02_00352999 predicted 1949
10 SASI_Rn02_00353000 predicted 1998
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390289 predicted 932
2 SASI_Rn02_00390290 predicted 1112
3 SASI_Rn02_00390291 predicted 1288
4 SASI_Rn02_00390292 predicted 1082
5 SASI_Rn02_00390293 predicted 1309
6 SASI_Rn02_00390294 predicted 645
7 SASI_Rn02_00390295 predicted 1483
8 SASI_Rn02_00390296 predicted 1392
9 SASI_Rn02_00390297 predicted 745
10 SASI_Rn02_00390298 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076421 predicted 1773
2 SASI_Mm01_00076422 predicted 995
3 SASI_Mm01_00076423 predicted 929
4 SASI_Mm01_00076424 predicted 932
5 SASI_Mm01_00076425 predicted 1619
6 SASI_Mm01_00076426 predicted 1760
7 SASI_Mm01_00076427 predicted 1744
8 SASI_Mm01_00076428 predicted 2028
9 SASI_Mm01_00076429 predicted 1104
10 SASI_Mm01_00076430 predicted 1810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014805
VALIDATED
EPM2AIP1 MISSION shRNA Bacterial Glycerol Stock
EPM2A (laforin) interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-964s1c1
Sequence:CCGGCGACCCATACTTTGAGGATGACTCGAGTCATCCTCAAAGTATGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-1823s1c1
Sequence:CCGGGTCTGCTGAATCCTACCCAATCTCGAGATTGGGTAGGATTCAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-2962s1c1
Sequence:CCGGGCGTGGGTATTGCTGCTTTATCTCGAGATAAAGCAGCAATACCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014805.2-1358s1c1
Sequence:CCGGGCTTTGTGACTTTGGCTTCTTCTCGAGAAGAAGCCAAAGTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-1169s1c1
Sequence:CCGGGCGACCTGAATTTCAGACTTTCTCGAGAAAGTCTGAAATTCAGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-287s21c1
Sequence:CCGGCGAGTGGACCCAGCGTTATTTCTCGAGAAATAACGCTGGGTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-843s21c1
Sequence:CCGGGAAGATCTTCTGACCATAATCCTCGAGGATTATGGTCAGAAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-1823s21c1
Sequence:CCGGGTCTGCTGAATCCTACCCAATCTCGAGATTGGGTAGGATTCAGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-1209s21c1
Sequence:CCGGGAGCATGGTGAAAGGGTTAATCTCGAGATTAACCCTTTCACCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014805
VALIDATED
EPM2AIP1 MISSION shRNA shRNA Plasmid DNA
EPM2A (laforin) interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-964s1c1
Sequence:CCGGCGACCCATACTTTGAGGATGACTCGAGTCATCCTCAAAGTATGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-1823s1c1
Sequence:CCGGGTCTGCTGAATCCTACCCAATCTCGAGATTGGGTAGGATTCAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-2962s1c1
Sequence:CCGGGCGTGGGTATTGCTGCTTTATCTCGAGATAAAGCAGCAATACCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014805.2-1358s1c1
Sequence:CCGGGCTTTGTGACTTTGGCTTCTTCTCGAGAAGAAGCCAAAGTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-1169s1c1
Sequence:CCGGGCGACCTGAATTTCAGACTTTCTCGAGAAAGTCTGAAATTCAGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-287s21c1
Sequence:CCGGCGAGTGGACCCAGCGTTATTTCTCGAGAAATAACGCTGGGTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-843s21c1
Sequence:CCGGGAAGATCTTCTGACCATAATCCTCGAGGATTATGGTCAGAAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-1823s21c1
Sequence:CCGGGTCTGCTGAATCCTACCCAATCTCGAGATTGGGTAGGATTCAGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-1209s21c1
Sequence:CCGGGAGCATGGTGAAAGGGTTAATCTCGAGATTAACCCTTTCACCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014805
VALIDATED
EPM2AIP1 MISSION shRNA Lentiviral Transduction Particles
EPM2A (laforin) interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-964s1c1
Sequence:CCGGCGACCCATACTTTGAGGATGACTCGAGTCATCCTCAAAGTATGGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-1823s1c1
Sequence:CCGGGTCTGCTGAATCCTACCCAATCTCGAGATTGGGTAGGATTCAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-2962s1c1
Sequence:CCGGGCGTGGGTATTGCTGCTTTATCTCGAGATAAAGCAGCAATACCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014805.2-1358s1c1
Sequence:CCGGGCTTTGTGACTTTGGCTTCTTCTCGAGAAGAAGCCAAAGTCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_014805.2-1169s1c1
Sequence:CCGGGCGACCTGAATTTCAGACTTTCTCGAGAAAGTCTGAAATTCAGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-287s21c1
Sequence:CCGGCGAGTGGACCCAGCGTTATTTCTCGAGAAATAACGCTGGGTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-843s21c1
Sequence:CCGGGAAGATCTTCTGACCATAATCCTCGAGGATTATGGTCAGAAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-1823s21c1
Sequence:CCGGGTCTGCTGAATCCTACCCAATCTCGAGATTGGGTAGGATTCAGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014805.3-1209s21c1
Sequence:CCGGGAGCATGGTGAAAGGGTTAATCTCGAGATTAACCCTTTCACCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175266
EPM2AIP1 MISSION shRNA Bacterial Glycerol Stock
EPM2A (laforin) interacting protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175266.2-3492s1c1
Sequence:CCGGCCCATCCTTCTCTGAGGAAATCTCGAGATTTCCTCAGAGAAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175266.2-858s1c1
Sequence:CCGGCGTAATCCACTATTCGGGATTCTCGAGAATCCCGAATAGTGGATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175266.2-936s1c1
Sequence:CCGGCATATCTGAATGGGTAGTTATCTCGAGATAACTACCCATTCAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175266.2-3832s1c1
Sequence:CCGGCCTAGTTACATCACTCTAAATCTCGAGATTTAGAGTGATGTAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175266
EPM2AIP1 MISSION shRNA shRNA Plasmid DNA
EPM2A (laforin) interacting protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175266.2-3492s1c1
Sequence:CCGGCCCATCCTTCTCTGAGGAAATCTCGAGATTTCCTCAGAGAAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175266.2-858s1c1
Sequence:CCGGCGTAATCCACTATTCGGGATTCTCGAGAATCCCGAATAGTGGATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175266.2-936s1c1
Sequence:CCGGCATATCTGAATGGGTAGTTATCTCGAGATAACTACCCATTCAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175266.2-3832s1c1
Sequence:CCGGCCTAGTTACATCACTCTAAATCTCGAGATTTAGAGTGATGTAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175266
EPM2AIP1 MISSION shRNA Lentiviral Transduction Particles
EPM2A (laforin) interacting protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175266.2-3492s1c1
Sequence:CCGGCCCATCCTTCTCTGAGGAAATCTCGAGATTTCCTCAGAGAAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175266.2-858s1c1
Sequence:CCGGCGTAATCCACTATTCGGGATTCTCGAGAATCCCGAATAGTGGATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175266.2-936s1c1
Sequence:CCGGCATATCTGAATGGGTAGTTATCTCGAGATAACTACCCATTCAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175266.2-3832s1c1
Sequence:CCGGCCTAGTTACATCACTCTAAATCTCGAGATTTAGAGTGATGTAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks