EMAIL THIS PAGE TO A FRIEND

EPN1

epsin 1

66 Gene Product Result for
UniProtKB ID: Q9Y6I3, Q86ST3, Q9HA18
Gene ID:
Human(29924) Summary: The protein encoded by this gene binds clathrin and is involved in the endocytosis of clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(13854) epsin 1
Rat(117277) Epsin 1
dog(608964) epsin 1
cow(508199) epsin 1
cow(782204) epsin-1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013333 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010147 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010147 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010147 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013333 Rosetta Predictions human pricing
NM_057136 Rosetta Predictions rat pricing
NM_010147 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116039 predicted 447
2 SASI_Hs01_00116040 predicted 532
3 SASI_Hs01_00116041 predicted 449
4 SASI_Hs01_00116042 predicted 669
5 SASI_Hs01_00116043 predicted 999
6 SASI_Hs01_00116044 predicted 376
7 SASI_Hs01_00116045 predicted 538
8 SASI_Hs01_00116046 predicted 364
9 SASI_Hs02_00344642 predicted 663
10 SASI_Hs02_00344643 predicted 1626
11 SASI_Hs01_00116047 predicted 1633
12 SASI_Hs01_00116048 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079321 predicted 1643
2 SASI_Rn01_00079322 predicted 1602
3 SASI_Rn01_00079323 predicted 355
4 SASI_Rn01_00079324 predicted 369
5 SASI_Rn01_00079325 predicted 1420
6 SASI_Rn01_00079326 predicted 208
7 SASI_Rn01_00079327 predicted 398
8 SASI_Rn01_00079328 predicted 1391
9 SASI_Rn01_00079329 predicted 304
10 SASI_Rn01_00079330 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070998 predicted 1777
2 SASI_Mm01_00070999 predicted 720
3 SASI_Mm01_00071000 predicted 526
4 SASI_Mm01_00071001 predicted 1768
5 SASI_Mm01_00071002 predicted 375
6 SASI_Mm01_00071003 predicted 1573
7 SASI_Mm01_00071004 predicted 1204
8 SASI_Mm01_00071005 predicted 591
9 SASI_Mm01_00071006 predicted 524
10 SASI_Mm01_00071007 predicted 470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013333
EPN1 MISSION shRNA Bacterial Glycerol Stock
epsin 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-1040s21c1
Sequence:GTACCGGTGGACCTTGCTGACGTCTTCACTCGAGTGAAGACGTCAGCAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-576s21c1
Sequence:GTACCGGGACGCTGATGGAGTACCTCATCTCGAGATGAGGTACTCCATCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-389s21c1
Sequence:GTACCGGACTACTCAGAGGCGGAGATCACTCGAGTGATCTCCGCCTCTGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013333.2-2026s1c2
Sequence:CCGGGTGTTGTGAGTGCATGTGAAACTCGAGTTTCACATGCACTCACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-518s21c1
Sequence:GTACCGGTGATCTGGAAGCGGCTCAATGCTCGAGCATTGAGCCGCTTCCAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-623s21c1
Sequence:GTACCGGAGCAGTGCAAGGAGAACATGTCTCGAGACATGTTCTCCTTGCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013333.3-2212s21c1
Sequence:GTACCGGCCCTTTCCCGTGGCATTAGAACTCGAGTTCTAATGCCACGGGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013333.3-2056s21c1
Sequence:GTACCGGAGTGTTGTGAGTGCATGTGAACTCGAGTTCACATGCACTCACAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-475s21c1
Sequence:GTACCGGGACCTCACCTACAACGTTGTCCTCGAGGACAACGTTGTAGGTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-1434s1c1
Sequence:CCGGCCCGACGAGTTCTCTGACTTTCTCGAGAAAGTCAGAGAACTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-1943s1c1
Sequence:CCGGCACTAATCCCTTCCTCCTATACTCGAGTATAGGAGGAAGGGATTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-524s1c1
Sequence:CCGGGCGTCACGTTTACAAGGCCATCTCGAGATGGCCTTGTAAACGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-548s1c1
Sequence:CCGGGCTGATGGAGTACCTCATCAACTCGAGTTGATGAGGTACTCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013333
EPN1 MISSION shRNA shRNA Plasmid DNA
epsin 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-1040s21c1
Sequence:GTACCGGTGGACCTTGCTGACGTCTTCACTCGAGTGAAGACGTCAGCAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-576s21c1
Sequence:GTACCGGGACGCTGATGGAGTACCTCATCTCGAGATGAGGTACTCCATCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-389s21c1
Sequence:GTACCGGACTACTCAGAGGCGGAGATCACTCGAGTGATCTCCGCCTCTGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013333.2-2026s1c2
Sequence:CCGGGTGTTGTGAGTGCATGTGAAACTCGAGTTTCACATGCACTCACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-518s21c1
Sequence:GTACCGGTGATCTGGAAGCGGCTCAATGCTCGAGCATTGAGCCGCTTCCAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-623s21c1
Sequence:GTACCGGAGCAGTGCAAGGAGAACATGTCTCGAGACATGTTCTCCTTGCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013333.3-2212s21c1
Sequence:GTACCGGCCCTTTCCCGTGGCATTAGAACTCGAGTTCTAATGCCACGGGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013333.3-2056s21c1
Sequence:GTACCGGAGTGTTGTGAGTGCATGTGAACTCGAGTTCACATGCACTCACAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-475s21c1
Sequence:GTACCGGGACCTCACCTACAACGTTGTCCTCGAGGACAACGTTGTAGGTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-1434s1c1
Sequence:CCGGCCCGACGAGTTCTCTGACTTTCTCGAGAAAGTCAGAGAACTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-1943s1c1
Sequence:CCGGCACTAATCCCTTCCTCCTATACTCGAGTATAGGAGGAAGGGATTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-524s1c1
Sequence:CCGGGCGTCACGTTTACAAGGCCATCTCGAGATGGCCTTGTAAACGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-548s1c1
Sequence:CCGGGCTGATGGAGTACCTCATCAACTCGAGTTGATGAGGTACTCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013333
EPN1 MISSION shRNA Lentiviral Transduction Particles
epsin 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-1040s21c1
Sequence:GTACCGGTGGACCTTGCTGACGTCTTCACTCGAGTGAAGACGTCAGCAAGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-576s21c1
Sequence:GTACCGGGACGCTGATGGAGTACCTCATCTCGAGATGAGGTACTCCATCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-389s21c1
Sequence:GTACCGGACTACTCAGAGGCGGAGATCACTCGAGTGATCTCCGCCTCTGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013333.2-2026s1c2
Sequence:CCGGGTGTTGTGAGTGCATGTGAAACTCGAGTTTCACATGCACTCACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-518s21c1
Sequence:GTACCGGTGATCTGGAAGCGGCTCAATGCTCGAGCATTGAGCCGCTTCCAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-623s21c1
Sequence:GTACCGGAGCAGTGCAAGGAGAACATGTCTCGAGACATGTTCTCCTTGCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013333.3-2212s21c1
Sequence:GTACCGGCCCTTTCCCGTGGCATTAGAACTCGAGTTCTAATGCCACGGGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013333.3-2056s21c1
Sequence:GTACCGGAGTGTTGTGAGTGCATGTGAACTCGAGTTCACATGCACTCACAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013333.3-475s21c1
Sequence:GTACCGGGACCTCACCTACAACGTTGTCCTCGAGGACAACGTTGTAGGTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-1434s1c1
Sequence:CCGGCCCGACGAGTTCTCTGACTTTCTCGAGAAAGTCAGAGAACTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-1943s1c1
Sequence:CCGGCACTAATCCCTTCCTCCTATACTCGAGTATAGGAGGAAGGGATTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-524s1c1
Sequence:CCGGGCGTCACGTTTACAAGGCCATCTCGAGATGGCCTTGTAAACGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013333.2-548s1c1
Sequence:CCGGGCTGATGGAGTACCTCATCAACTCGAGTTGATGAGGTACTCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010147
VALIDATED
EPN1 MISSION shRNA Bacterial Glycerol Stock
epsin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010147.2-2437s1c1
Sequence:CCGGCCCTGGTGAATCCTTGGTGATCTCGAGATCACCAAGGATTCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010147.2-2002s1c1
Sequence:CCGGCCCACCTATATCTCTCCTCTTCTCGAGAAGAGGAGAGATATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010147.2-396s1c1
Sequence:CCGGGATGAAGAATATCGTCCACAACTCGAGTTGTGGACGATATTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010147.2-807s1c1
Sequence:CCGGCGCGCTCAAGACCAAGGAGAACTCGAGTTCTCCTTGGTCTTGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010147.2-640s1c1
Sequence:CCGGCGTGTATCACAACAGTGCAAACTCGAGTTTGCACTGTTGTGATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010147
VALIDATED
EPN1 MISSION shRNA shRNA Plasmid DNA
epsin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010147.2-2437s1c1
Sequence:CCGGCCCTGGTGAATCCTTGGTGATCTCGAGATCACCAAGGATTCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010147.2-2002s1c1
Sequence:CCGGCCCACCTATATCTCTCCTCTTCTCGAGAAGAGGAGAGATATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010147.2-396s1c1
Sequence:CCGGGATGAAGAATATCGTCCACAACTCGAGTTGTGGACGATATTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010147.2-807s1c1
Sequence:CCGGCGCGCTCAAGACCAAGGAGAACTCGAGTTCTCCTTGGTCTTGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010147.2-640s1c1
Sequence:CCGGCGTGTATCACAACAGTGCAAACTCGAGTTTGCACTGTTGTGATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010147
VALIDATED
EPN1 MISSION shRNA Lentiviral Transduction Particles
epsin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010147.2-2437s1c1
Sequence:CCGGCCCTGGTGAATCCTTGGTGATCTCGAGATCACCAAGGATTCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010147.2-2002s1c1
Sequence:CCGGCCCACCTATATCTCTCCTCTTCTCGAGAAGAGGAGAGATATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010147.2-396s1c1
Sequence:CCGGGATGAAGAATATCGTCCACAACTCGAGTTGTGGACGATATTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010147.2-807s1c1
Sequence:CCGGCGCGCTCAAGACCAAGGAGAACTCGAGTTCTCCTTGGTCTTGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010147.2-640s1c1
Sequence:CCGGCGTGTATCACAACAGTGCAAACTCGAGTTTGCACTGTTGTGATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks