EMAIL THIS PAGE TO A FRIEND

EPN2

epsin 2

152 Gene Product Result for
Synonyms: EHB21
Gene ID:
Human(22905) Summary: This gene encodes a protein which interacts with clathrin and adaptor-related protein complex 2, alpha 1 subunit. The protein is found in a brain-derived clathrin-coated vesicle fraction and localizes to the peri-Golgi region and the cell periphery. The protein is thought to be involved in clathrin-mediated endocytosis. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(13855) epsin 2
Rat(60443) epsin 2
dog(489533) epsin 2
cow(505336) epsin 2
chicken(416524) epsin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_148921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148921 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087821 MISSION® esiRNA esiRNA human EPN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102664 Rosetta Predictions human pricing
NM_014964 Rosetta Predictions human pricing
NM_148921 Rosetta Predictions human pricing
NM_001033914 Rosetta Predictions rat pricing
NM_021852 Rosetta Predictions rat pricing
NM_010148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323492 predicted 1439
2 SASI_Hs02_00323493 predicted 1757
3 SASI_Hs02_00323494 predicted 1727
4 SASI_Hs02_00323495 predicted 378
5 SASI_Hs02_00323496 predicted 1426
6 SASI_Hs02_00323497 predicted 1790
7 SASI_Hs02_00323498 predicted 373
8 SASI_Hs02_00323499 predicted 1790
9 SASI_Hs02_00323500 predicted 1464
10 SASI_Hs02_00323501 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174282 predicted 2500
2 SASI_Hs01_00174283 predicted 2813
3 SASI_Hs01_00174284 predicted 2777
4 SASI_Hs01_00174285 predicted 1439
5 SASI_Hs01_00174286 predicted 2490
6 SASI_Hs02_00346658 predicted 2846
7 SASI_Hs02_00346659 predicted 1430
8 SASI_Hs01_00174287 predicted 2852
9 SASI_Hs01_00174288 predicted 2523
10 SASI_Hs02_00346660 predicted 1438
11 SASI_Hs01_00174279 predicted 432
12 SASI_Hs01_00174280 predicted 792
13 SASI_Hs01_00174281 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226276 predicted 2323
2 SASI_Hs01_00226277 predicted 2649
3 SASI_Hs01_00226278 predicted 2610
4 SASI_Hs01_00226279 predicted 1265
5 SASI_Hs01_00226280 predicted 2316
6 SASI_Hs02_00365652 predicted 2681
7 SASI_Hs02_00365653 predicted 1260
8 SASI_Hs01_00226281 predicted 2673
9 SASI_Hs01_00226282 predicted 2352
10 SASI_Hs02_00365654 predicted 1265
11 SASI_Hs01_00226273 predicted 438
12 SASI_Hs01_00226274 predicted 796
13 SASI_Hs01_00226275 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119482 predicted 610
2 SASI_Rn01_00119483 predicted 1910
3 SASI_Rn01_00119484 predicted 607
4 SASI_Rn01_00119485 predicted 2156
5 SASI_Rn01_00119486 predicted 418
6 SASI_Rn01_00119487 predicted 442
7 SASI_Rn01_00119488 predicted 457
8 SASI_Rn01_00119489 predicted 425
9 SASI_Rn01_00119490 predicted 1266
10 SASI_Rn02_00203824 predicted 2101
11 SASI_Rn01_00119491 predicted 1996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108025 predicted 609
2 SASI_Rn01_00108026 predicted 1732
3 SASI_Rn01_00108027 predicted 610
4 SASI_Rn01_00108028 predicted 1981
5 SASI_Rn01_00108029 predicted 418
6 SASI_Rn01_00108030 predicted 437
7 SASI_Rn01_00108031 predicted 456
8 SASI_Rn01_00108032 predicted 432
9 SASI_Rn01_00108033 predicted 1099
10 SASI_Rn02_00262879 predicted 1929
11 SASI_Rn01_00108034 predicted 1823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033993 predicted 411
2 SASI_Mm01_00033994 predicted 1581
3 SASI_Mm01_00033995 predicted 1006
4 SASI_Mm01_00033996 predicted 1995
5 SASI_Mm02_00317895 predicted 432
6 SASI_Mm01_00033997 predicted 422
7 SASI_Mm01_00033998 predicted 603
8 SASI_Mm01_00033999 predicted 1127
9 SASI_Mm01_00034000 predicted 385
10 SASI_Mm01_00034002 predicted 287
11 SASI_Mm01_00034001 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010148
VALIDATED
EPN2 MISSION shRNA Bacterial Glycerol Stock
epsin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010148.1-3310s1c1
Sequence:CCGGCCAGGAAGTAACCACATCCTACTCGAGTAGGATGTGGTTACTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010148.1-1476s1c1
Sequence:CCGGCGGTACAGTTAAAGATGATTTCTCGAGAAATCATCTTTAACTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010148.1-425s1c1
Sequence:CCGGGCATGGTTTGGAAGCGACTTACTCGAGTAAGTCGCTTCCAAACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010148.1-1587s1c1
Sequence:CCGGCCTCTTTGAGTCTCAATCCTTCTCGAGAAGGATTGAGACTCAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010148.1-856s1c1
Sequence:CCGGCCACGAGTATCCTCTGAGTTACTCGAGTAACTCAGAGGATACTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-425s21c1
Sequence:CCGGGCATGGTTTGGAAGCGACTTACTCGAGTAAGTCGCTTCCAAACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-1476s21c1
Sequence:CCGGCGGTACAGTTAAAGATGATTTCTCGAGAAATCATCTTTAACTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-1587s21c1
Sequence:CCGGCCTCTTTGAGTCTCAATCCTTCTCGAGAAGGATTGAGACTCAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294656    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-2491s21c1
Sequence:CCGGCCTACCAGTGTGGAGCTTTAACTCGAGTTAAAGCTCCACACTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-1241s21c1
Sequence:CCGGCAGTGGCTCCTTCGAACATTACTCGAGTAATGTTCGAAGGAGCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010148
VALIDATED
EPN2 MISSION shRNA shRNA Plasmid DNA
epsin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010148.1-3310s1c1
Sequence:CCGGCCAGGAAGTAACCACATCCTACTCGAGTAGGATGTGGTTACTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010148.1-1476s1c1
Sequence:CCGGCGGTACAGTTAAAGATGATTTCTCGAGAAATCATCTTTAACTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010148.1-425s1c1
Sequence:CCGGGCATGGTTTGGAAGCGACTTACTCGAGTAAGTCGCTTCCAAACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010148.1-1587s1c1
Sequence:CCGGCCTCTTTGAGTCTCAATCCTTCTCGAGAAGGATTGAGACTCAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010148.1-856s1c1
Sequence:CCGGCCACGAGTATCCTCTGAGTTACTCGAGTAACTCAGAGGATACTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-425s21c1
Sequence:CCGGGCATGGTTTGGAAGCGACTTACTCGAGTAAGTCGCTTCCAAACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-1476s21c1
Sequence:CCGGCGGTACAGTTAAAGATGATTTCTCGAGAAATCATCTTTAACTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-1587s21c1
Sequence:CCGGCCTCTTTGAGTCTCAATCCTTCTCGAGAAGGATTGAGACTCAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294656    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-2491s21c1
Sequence:CCGGCCTACCAGTGTGGAGCTTTAACTCGAGTTAAAGCTCCACACTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-1241s21c1
Sequence:CCGGCAGTGGCTCCTTCGAACATTACTCGAGTAATGTTCGAAGGAGCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010148
VALIDATED
EPN2 MISSION shRNA Lentiviral Transduction Particles
epsin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010148.1-3310s1c1
Sequence:CCGGCCAGGAAGTAACCACATCCTACTCGAGTAGGATGTGGTTACTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010148.1-1476s1c1
Sequence:CCGGCGGTACAGTTAAAGATGATTTCTCGAGAAATCATCTTTAACTGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010148.1-425s1c1
Sequence:CCGGGCATGGTTTGGAAGCGACTTACTCGAGTAAGTCGCTTCCAAACCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010148.1-1587s1c1
Sequence:CCGGCCTCTTTGAGTCTCAATCCTTCTCGAGAAGGATTGAGACTCAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010148.1-856s1c1
Sequence:CCGGCCACGAGTATCCTCTGAGTTACTCGAGTAACTCAGAGGATACTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-425s21c1
Sequence:CCGGGCATGGTTTGGAAGCGACTTACTCGAGTAAGTCGCTTCCAAACCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-1476s21c1
Sequence:CCGGCGGTACAGTTAAAGATGATTTCTCGAGAAATCATCTTTAACTGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-1587s21c1
Sequence:CCGGCCTCTTTGAGTCTCAATCCTTCTCGAGAAGGATTGAGACTCAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294656    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-2491s21c1
Sequence:CCGGCCTACCAGTGTGGAGCTTTAACTCGAGTTAAAGCTCCACACTGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010148.2-1241s21c1
Sequence:CCGGCAGTGGCTCCTTCGAACATTACTCGAGTAATGTTCGAAGGAGCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148921
EPN2 MISSION shRNA Bacterial Glycerol Stock
epsin 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-537s1c1
Sequence:CCGGAGTTCTCTGATGACCGAGATTCTCGAGAATCTCGGTCATCAGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-1250s1c1
Sequence:CCGGGACTACGCTGTTGGATTTAATCTCGAGATTAAATCCAACAGCGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-822s1c1
Sequence:CCGGGCTCTCCTCAAGGACGAGGAACTCGAGTTCCTCGTCCTTGAGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-2096s1c1
Sequence:CCGGCCCTGCAATGATGAACATGGTCTCGAGACCATGTTCATCATTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-485s21c1
Sequence:GTACCGGATCGTGAACAATTACTCAGAGCTCGAGCTCTGAGTAATTGTTCACGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1269s21c1
Sequence:GTACCGGAGACTACGCTGTTGGATTTAACTCGAGTTAAATCCAACAGCGTAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148921.2-2693s1c2
Sequence:CCGGCGTGGACAACTCTTGAATTAACTCGAGTTAATTCAAGAGTTGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148921.3-3978s21c1
Sequence:CCGGCGGCACAGGAGAGATCTTAAACTCGAGTTTAAGATCTCTCCTGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-2132s21c1
Sequence:CCGGATGGTGGGCAGTGTGGGTATACTCGAGTATACCCACACTGCCCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1619s21c1
Sequence:CCGGAGTAATCTGAATGGTACAATTCTCGAGAATTGTACCATTCAGATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-933s21c1
Sequence:CCGGGCAGCAACCAGATCACCTTTGCTCGAGCAAAGGTGATCTGGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-556s21c1
Sequence:GTACCGGCAGTTCTCTGATGACCGAGATCTCGAGATCTCGGTCATCAGAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1466s21c1
Sequence:GTACCGGACTGGAGCCACCGTACAATCTCTCGAGAGATTGTACGGTGGCTCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1590s21c1
Sequence:GTACCGGTGTCTGTCTCTGGGTCCTTTGCTCGAGCAAAGGACCCAGAGACAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1174s21c1
Sequence:GTACCGGGGGTGATGACCTCAGATTACACTCGAGTGTAATCTGAGGTCATCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148921
EPN2 MISSION shRNA shRNA Plasmid DNA
epsin 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-537s1c1
Sequence:CCGGAGTTCTCTGATGACCGAGATTCTCGAGAATCTCGGTCATCAGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-1250s1c1
Sequence:CCGGGACTACGCTGTTGGATTTAATCTCGAGATTAAATCCAACAGCGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-822s1c1
Sequence:CCGGGCTCTCCTCAAGGACGAGGAACTCGAGTTCCTCGTCCTTGAGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-2096s1c1
Sequence:CCGGCCCTGCAATGATGAACATGGTCTCGAGACCATGTTCATCATTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-485s21c1
Sequence:GTACCGGATCGTGAACAATTACTCAGAGCTCGAGCTCTGAGTAATTGTTCACGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1269s21c1
Sequence:GTACCGGAGACTACGCTGTTGGATTTAACTCGAGTTAAATCCAACAGCGTAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148921.2-2693s1c2
Sequence:CCGGCGTGGACAACTCTTGAATTAACTCGAGTTAATTCAAGAGTTGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148921.3-3978s21c1
Sequence:CCGGCGGCACAGGAGAGATCTTAAACTCGAGTTTAAGATCTCTCCTGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-2132s21c1
Sequence:CCGGATGGTGGGCAGTGTGGGTATACTCGAGTATACCCACACTGCCCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1619s21c1
Sequence:CCGGAGTAATCTGAATGGTACAATTCTCGAGAATTGTACCATTCAGATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-933s21c1
Sequence:CCGGGCAGCAACCAGATCACCTTTGCTCGAGCAAAGGTGATCTGGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-556s21c1
Sequence:GTACCGGCAGTTCTCTGATGACCGAGATCTCGAGATCTCGGTCATCAGAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1466s21c1
Sequence:GTACCGGACTGGAGCCACCGTACAATCTCTCGAGAGATTGTACGGTGGCTCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1590s21c1
Sequence:GTACCGGTGTCTGTCTCTGGGTCCTTTGCTCGAGCAAAGGACCCAGAGACAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1174s21c1
Sequence:GTACCGGGGGTGATGACCTCAGATTACACTCGAGTGTAATCTGAGGTCATCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148921
EPN2 MISSION shRNA Lentiviral Transduction Particles
epsin 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-537s1c1
Sequence:CCGGAGTTCTCTGATGACCGAGATTCTCGAGAATCTCGGTCATCAGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-1250s1c1
Sequence:CCGGGACTACGCTGTTGGATTTAATCTCGAGATTAAATCCAACAGCGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-822s1c1
Sequence:CCGGGCTCTCCTCAAGGACGAGGAACTCGAGTTCCTCGTCCTTGAGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148921.2-2096s1c1
Sequence:CCGGCCCTGCAATGATGAACATGGTCTCGAGACCATGTTCATCATTGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-485s21c1
Sequence:GTACCGGATCGTGAACAATTACTCAGAGCTCGAGCTCTGAGTAATTGTTCACGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1269s21c1
Sequence:GTACCGGAGACTACGCTGTTGGATTTAACTCGAGTTAAATCCAACAGCGTAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148921.2-2693s1c2
Sequence:CCGGCGTGGACAACTCTTGAATTAACTCGAGTTAATTCAAGAGTTGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148921.3-3978s21c1
Sequence:CCGGCGGCACAGGAGAGATCTTAAACTCGAGTTTAAGATCTCTCCTGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-2132s21c1
Sequence:CCGGATGGTGGGCAGTGTGGGTATACTCGAGTATACCCACACTGCCCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1619s21c1
Sequence:CCGGAGTAATCTGAATGGTACAATTCTCGAGAATTGTACCATTCAGATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-933s21c1
Sequence:CCGGGCAGCAACCAGATCACCTTTGCTCGAGCAAAGGTGATCTGGTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-556s21c1
Sequence:GTACCGGCAGTTCTCTGATGACCGAGATCTCGAGATCTCGGTCATCAGAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1466s21c1
Sequence:GTACCGGACTGGAGCCACCGTACAATCTCTCGAGAGATTGTACGGTGGCTCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1590s21c1
Sequence:GTACCGGTGTCTGTCTCTGGGTCCTTTGCTCGAGCAAAGGACCCAGAGACAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148921.3-1174s21c1
Sequence:GTACCGGGGGTGATGACCTCAGATTACACTCGAGTGTAATCTGAGGTCATCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)