EMAIL THIS PAGE TO A FRIEND
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017957 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123351 MISSION® esiRNA esiRNA human EPN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017957 Rosetta Predictions human pricing
NM_001024791 Rosetta Predictions rat pricing
NM_027984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152893 predicted 796
2 SASI_Hs01_00152894 predicted 793
3 SASI_Hs01_00152896 predicted 1702
4 SASI_Hs01_00152897 predicted 536
5 SASI_Hs01_00152898 predicted 573
6 SASI_Hs01_00152899 predicted 722
7 SASI_Hs01_00152900 predicted 619
8 SASI_Hs01_00152901 predicted 659
9 SASI_Hs02_00350990 predicted 1775
10 SASI_Hs01_00152902 predicted 889
11 SASI_Hs01_00152895 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069613 predicted 2372
2 SASI_Rn01_00069614 predicted 1135
3 SASI_Rn01_00069615 predicted 2345
4 SASI_Rn01_00069616 predicted 528
5 SASI_Rn01_00069617 predicted 1326
6 SASI_Rn01_00069618 predicted 2362
7 SASI_Rn01_00069619 predicted 314
8 SASI_Rn01_00069620 predicted 1963
9 SASI_Rn01_00069621 predicted 1484
10 SASI_Rn01_00069622 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153459 predicted 732
2 SASI_Mm01_00153460 predicted 1425
3 SASI_Mm01_00153461 predicted 1711
4 SASI_Mm01_00153462 predicted 1707
5 SASI_Mm01_00153463 predicted 1968
6 SASI_Mm02_00333036 predicted 1766
7 SASI_Mm01_00153464 predicted 685
8 SASI_Mm01_00153465 predicted 1430
9 SASI_Mm01_00153466 predicted 693
10 SASI_Mm01_00153467 predicted 825
11 SASI_Mm01_00153458 predicted 757
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017957
EPN3 MISSION shRNA Bacterial Glycerol Stock
epsin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017957.2-625s21c1
Sequence:CCGGCTCAATGACAGCGGCAAGAACCTCGAGGTTCTTGCCGCTGTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.2-655s1c1
Sequence:CCGGGTGTACAAGGCTCTAACATTGCTCGAGCAATGTTAGAGCCTTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.2-585s1c1
Sequence:CCGGAGTGGCCTTCACCGAAGTCATCTCGAGATGACTTCGGTGAAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017957.2-2809s21c1
Sequence:CCGGTAGGCCTTTGTTCCTATTTATCTCGAGATAAATAGGAACAAAGGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017957.2-543s21c1
Sequence:CCGGTAGTTCGCTCATGTCCGAGATCTCGAGATCTCGGACATGAGCGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017957.1-2684s1c1
Sequence:CCGGGCTGTCACTCAATTCGGTCATCTCGAGATGACCGAATTGAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.1-1644s1c1
Sequence:CCGGGACCTTTGACCCATTTGCCAACTCGAGTTGGCAAATGGGTCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.1-684s1c1
Sequence:CCGGCTACACCATCCAGACACTCAACTCGAGTTGAGTGTCTGGATGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017957
EPN3 MISSION shRNA shRNA Plasmid DNA
epsin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017957.2-625s21c1
Sequence:CCGGCTCAATGACAGCGGCAAGAACCTCGAGGTTCTTGCCGCTGTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.2-655s1c1
Sequence:CCGGGTGTACAAGGCTCTAACATTGCTCGAGCAATGTTAGAGCCTTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.2-585s1c1
Sequence:CCGGAGTGGCCTTCACCGAAGTCATCTCGAGATGACTTCGGTGAAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017957.2-2809s21c1
Sequence:CCGGTAGGCCTTTGTTCCTATTTATCTCGAGATAAATAGGAACAAAGGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017957.2-543s21c1
Sequence:CCGGTAGTTCGCTCATGTCCGAGATCTCGAGATCTCGGACATGAGCGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017957.1-2684s1c1
Sequence:CCGGGCTGTCACTCAATTCGGTCATCTCGAGATGACCGAATTGAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.1-1644s1c1
Sequence:CCGGGACCTTTGACCCATTTGCCAACTCGAGTTGGCAAATGGGTCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.1-684s1c1
Sequence:CCGGCTACACCATCCAGACACTCAACTCGAGTTGAGTGTCTGGATGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017957
EPN3 MISSION shRNA Lentiviral Transduction Particles
epsin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017957.2-625s21c1
Sequence:CCGGCTCAATGACAGCGGCAAGAACCTCGAGGTTCTTGCCGCTGTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.2-655s1c1
Sequence:CCGGGTGTACAAGGCTCTAACATTGCTCGAGCAATGTTAGAGCCTTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.2-585s1c1
Sequence:CCGGAGTGGCCTTCACCGAAGTCATCTCGAGATGACTTCGGTGAAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017957.2-2809s21c1
Sequence:CCGGTAGGCCTTTGTTCCTATTTATCTCGAGATAAATAGGAACAAAGGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017957.2-543s21c1
Sequence:CCGGTAGTTCGCTCATGTCCGAGATCTCGAGATCTCGGACATGAGCGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017957.1-2684s1c1
Sequence:CCGGGCTGTCACTCAATTCGGTCATCTCGAGATGACCGAATTGAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.1-1644s1c1
Sequence:CCGGGACCTTTGACCCATTTGCCAACTCGAGTTGGCAAATGGGTCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017957.1-684s1c1
Sequence:CCGGCTACACCATCCAGACACTCAACTCGAGTTGAGTGTCTGGATGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027984
EPN3 MISSION shRNA Bacterial Glycerol Stock
epsin 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-574s21c1
Sequence:GTACCGGTAAGAACTGGCGACACGTATACTCGAGTATACGTGTCGCCAGTTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-2270s21c1
Sequence:GTACCGGCCCTTCCTCTGAGACGCTTTACTCGAGTAAAGCGTCTCAGAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-735s21c1
Sequence:GTACCGGATGTTCGTGAGAAGGTCAAACCTCGAGGTTTGACCTTCTCACGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-1630s21c1
Sequence:GTACCGGATTTGCCAAACCTCTAGAATCCTCGAGGATTCTAGAGGTTTGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-1712s21c1
Sequence:GTACCGGACTGTGGAGCTAGACCCATTTCTCGAGAAATGGGTCTAGCTCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-1435s21c1
Sequence:GTACCGGGGATTTGCTTCCTACTCTTTCCTCGAGGAAAGAGTAGGAAGCAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-2007s1c1
Sequence:CCGGCGACCCTAAACCAGATGCGTACTCGAGTACGCATCTGGTTTAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-1873s1c1
Sequence:CCGGCTCTGCCTCTTCTTTGGTCAACTCGAGTTGACCAAAGAAGAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-400s1c1
Sequence:CCGGGAAGAACATTGTTCACAACTACTCGAGTAGTTGTGAACAATGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-658s1c1
Sequence:CCGGCCGCGAGAACCTCTACACTATCTCGAGATAGTGTAGAGGTTCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-559s1c1
Sequence:CCGGGCTCAATGACAGCGGTAAGAACTCGAGTTCTTACCGCTGTCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027984
EPN3 MISSION shRNA shRNA Plasmid DNA
epsin 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-574s21c1
Sequence:GTACCGGTAAGAACTGGCGACACGTATACTCGAGTATACGTGTCGCCAGTTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-2270s21c1
Sequence:GTACCGGCCCTTCCTCTGAGACGCTTTACTCGAGTAAAGCGTCTCAGAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-735s21c1
Sequence:GTACCGGATGTTCGTGAGAAGGTCAAACCTCGAGGTTTGACCTTCTCACGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-1630s21c1
Sequence:GTACCGGATTTGCCAAACCTCTAGAATCCTCGAGGATTCTAGAGGTTTGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-1712s21c1
Sequence:GTACCGGACTGTGGAGCTAGACCCATTTCTCGAGAAATGGGTCTAGCTCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-1435s21c1
Sequence:GTACCGGGGATTTGCTTCCTACTCTTTCCTCGAGGAAAGAGTAGGAAGCAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-2007s1c1
Sequence:CCGGCGACCCTAAACCAGATGCGTACTCGAGTACGCATCTGGTTTAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-1873s1c1
Sequence:CCGGCTCTGCCTCTTCTTTGGTCAACTCGAGTTGACCAAAGAAGAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-400s1c1
Sequence:CCGGGAAGAACATTGTTCACAACTACTCGAGTAGTTGTGAACAATGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-658s1c1
Sequence:CCGGCCGCGAGAACCTCTACACTATCTCGAGATAGTGTAGAGGTTCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-559s1c1
Sequence:CCGGGCTCAATGACAGCGGTAAGAACTCGAGTTCTTACCGCTGTCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027984
EPN3 MISSION shRNA Lentiviral Transduction Particles
epsin 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-574s21c1
Sequence:GTACCGGTAAGAACTGGCGACACGTATACTCGAGTATACGTGTCGCCAGTTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-2270s21c1
Sequence:GTACCGGCCCTTCCTCTGAGACGCTTTACTCGAGTAAAGCGTCTCAGAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-735s21c1
Sequence:GTACCGGATGTTCGTGAGAAGGTCAAACCTCGAGGTTTGACCTTCTCACGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-1630s21c1
Sequence:GTACCGGATTTGCCAAACCTCTAGAATCCTCGAGGATTCTAGAGGTTTGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-1712s21c1
Sequence:GTACCGGACTGTGGAGCTAGACCCATTTCTCGAGAAATGGGTCTAGCTCCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027984.2-1435s21c1
Sequence:GTACCGGGGATTTGCTTCCTACTCTTTCCTCGAGGAAAGAGTAGGAAGCAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-2007s1c1
Sequence:CCGGCGACCCTAAACCAGATGCGTACTCGAGTACGCATCTGGTTTAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-1873s1c1
Sequence:CCGGCTCTGCCTCTTCTTTGGTCAACTCGAGTTGACCAAAGAAGAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-400s1c1
Sequence:CCGGGAAGAACATTGTTCACAACTACTCGAGTAGTTGTGAACAATGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-658s1c1
Sequence:CCGGCCGCGAGAACCTCTACACTATCTCGAGATAGTGTAGAGGTTCTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027984.1-559s1c1
Sequence:CCGGGCTCAATGACAGCGGTAAGAACTCGAGTTCTTACCGCTGTCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks