EMAIL THIS PAGE TO A FRIEND

EPO

erythropoietin

77 Gene Product Result for
Synonyms: EP MVCD2
UniProtKB ID: P01588, Q2M2L6, Q549U2, Q9UDZ0, Q9UEZ5, Q9UHA0
Gene ID:
Human(2056) Summary: This gene is a member of the EPO/TPO family and encodes a secreted, glycosylated cytokine composed of four alpha helical bundles. The protein is found in the plasma and regulates red cell production by promoting erythroid differentiation and initiating hemoglobin synthesis. This protein also has neuroprotective activity against a variety of potential brain injuries and antiapoptotic functions in several tissue types. [provided by RefSeq, Jul 2008]
Mouse(13856) erythropoietin
Rat(24335) erythropoietin
naked mole-rat(101730050) erythropoietin
sheep(443302) erythropoietin
Zebrafish(100004455) erythropoietin
cow(280784) erythropoietin
Horse(100033849) erythropoietin
domestic cat(493801) erythropoietin
dog(404002) erythropoietin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000799 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072471 MISSION® esiRNA esiRNA targeting mouse Epo (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000799 Rosetta Predictions human pricing
NM_017001 Rosetta Predictions rat pricing
NM_007942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203044 predicted 990
2 SASI_Hs01_00203045 predicted 659
3 SASI_Hs01_00203046 predicted 930
4 SASI_Hs01_00203047 predicted 314
5 SASI_Hs01_00203048 predicted 673
6 SASI_Hs01_00203049 predicted 657
7 SASI_Hs01_00203051 predicted 378
8 SASI_Hs01_00203052 predicted 273
9 SASI_Hs01_00203053 predicted 1019
10 SASI_Hs02_00303246 predicted 345
11 SASI_Hs01_00203050 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050156 predicted 502
2 SASI_Rn01_00050157 predicted 393
3 SASI_Rn02_00261150 predicted 801
4 SASI_Rn01_00050159 predicted 489
5 SASI_Rn01_00050160 predicted 719
6 SASI_Rn01_00050161 predicted 801
7 SASI_Rn01_00050162 predicted 261
8 SASI_Rn01_00050163 predicted 482
9 SASI_Rn01_00050164 predicted 382
10 SASI_Rn01_00050165 predicted 216
11 SASI_Rn01_00050158 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091008 predicted 406
2 SASI_Mm01_00091009 predicted 415
3 SASI_Mm02_00312787 predicted 456
4 SASI_Mm01_00091012 predicted 409
5 SASI_Mm02_00312788 predicted 477
6 SASI_Mm01_00091013 predicted 320
7 SASI_Mm01_00091014 predicted 273
8 SASI_Mm01_00091017 predicted 283
9 SASI_Mm02_00312789 predicted 438
10 SASI_Mm02_00312790 predicted 318
11 SASI_Mm01_00091010 predicted 338
12 SASI_Mm01_00091011 predicted 243
13 SASI_Mm01_00091015 predicted 309
14 SASI_Mm01_00091016 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000799
EPO MISSION shRNA Bacterial Glycerol Stock
erythropoietin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-385s1c1
Sequence:CCGGCCCAGACACCAAAGTTAATTTCTCGAGAAATTAACTTTGGTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-654s1c1
Sequence:CCGGGAACAATCACTGCTGACACTTCTCGAGAAGTGTCAGCAGTGATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-350s1c1
Sequence:CCGGGCTGAACACTGCAGCTTGAATCTCGAGATTCAAGCTGCAGTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-688s1c1
Sequence:CCGGCCGAGTCTACTCCAATTTCCTCTCGAGAGGAAATTGGAGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-676s1c1
Sequence:CCGGCCGCAAACTCTTCCGAGTCTACTCGAGTAGACTCGGAAGAGTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000799.2-534s21c1
Sequence:CCGGTGCAGCTGCATGTGGATAAAGCTCGAGCTTTATCCACATGCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000799.2-936s21c1
Sequence:CCGGAGAGCAACTCTGAGATCTAAGCTCGAGCTTAGATCTCAGAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000799
EPO MISSION shRNA shRNA Plasmid DNA
erythropoietin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-385s1c1
Sequence:CCGGCCCAGACACCAAAGTTAATTTCTCGAGAAATTAACTTTGGTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-654s1c1
Sequence:CCGGGAACAATCACTGCTGACACTTCTCGAGAAGTGTCAGCAGTGATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-350s1c1
Sequence:CCGGGCTGAACACTGCAGCTTGAATCTCGAGATTCAAGCTGCAGTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-688s1c1
Sequence:CCGGCCGAGTCTACTCCAATTTCCTCTCGAGAGGAAATTGGAGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-676s1c1
Sequence:CCGGCCGCAAACTCTTCCGAGTCTACTCGAGTAGACTCGGAAGAGTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000799.2-534s21c1
Sequence:CCGGTGCAGCTGCATGTGGATAAAGCTCGAGCTTTATCCACATGCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000799.2-936s21c1
Sequence:CCGGAGAGCAACTCTGAGATCTAAGCTCGAGCTTAGATCTCAGAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000799
EPO MISSION shRNA Lentiviral Transduction Particles
erythropoietin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-385s1c1
Sequence:CCGGCCCAGACACCAAAGTTAATTTCTCGAGAAATTAACTTTGGTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-654s1c1
Sequence:CCGGGAACAATCACTGCTGACACTTCTCGAGAAGTGTCAGCAGTGATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-350s1c1
Sequence:CCGGGCTGAACACTGCAGCTTGAATCTCGAGATTCAAGCTGCAGTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-688s1c1
Sequence:CCGGCCGAGTCTACTCCAATTTCCTCTCGAGAGGAAATTGGAGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000799.1-676s1c1
Sequence:CCGGCCGCAAACTCTTCCGAGTCTACTCGAGTAGACTCGGAAGAGTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000799.2-534s21c1
Sequence:CCGGTGCAGCTGCATGTGGATAAAGCTCGAGCTTTATCCACATGCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000799.2-936s21c1
Sequence:CCGGAGAGCAACTCTGAGATCTAAGCTCGAGCTTAGATCTCAGAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007942
EPO MISSION shRNA Bacterial Glycerol Stock
erythropoietin
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000066658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-214s1c1
Sequence:CCGGGTCAACTTCTATGCTTGGAAACTCGAGTTTCCAAGCATAGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-354s1c1
Sequence:CCGGGCTTCATATAGACAAAGCCATCTCGAGATGGCTTTGTCTATATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-201s1c1
Sequence:CCGGCCCAGATACCAAAGTCAACTTCTCGAGAAGTTGACTTTGGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-109s1c1
Sequence:CCGGGTTCTGGAGAGGTACATCTTACTCGAGTAAGATGTACCTCTCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007942
EPO MISSION shRNA shRNA Plasmid DNA
erythropoietin
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000066658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-214s1c1
Sequence:CCGGGTCAACTTCTATGCTTGGAAACTCGAGTTTCCAAGCATAGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-354s1c1
Sequence:CCGGGCTTCATATAGACAAAGCCATCTCGAGATGGCTTTGTCTATATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-201s1c1
Sequence:CCGGCCCAGATACCAAAGTCAACTTCTCGAGAAGTTGACTTTGGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-109s1c1
Sequence:CCGGGTTCTGGAGAGGTACATCTTACTCGAGTAAGATGTACCTCTCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007942
EPO MISSION shRNA Lentiviral Transduction Particles
erythropoietin
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000066658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-214s1c1
Sequence:CCGGGTCAACTTCTATGCTTGGAAACTCGAGTTTCCAAGCATAGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-354s1c1
Sequence:CCGGGCTTCATATAGACAAAGCCATCTCGAGATGGCTTTGTCTATATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-201s1c1
Sequence:CCGGCCCAGATACCAAAGTCAACTTCTCGAGAAGTTGACTTTGGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007942.1-109s1c1
Sequence:CCGGGTTCTGGAGAGGTACATCTTACTCGAGTAAGATGTACCTCTCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks