EMAIL THIS PAGE TO A FRIEND

EPOR

erythropoietin receptor

72 Gene Product Result for
Synonyms: EPO-R
UniProtKB ID: P19235, B2RCG4, Q15443, Q2M205
Gene ID:
Human(2057) Summary: This gene encodes the erythropoietin receptor which is a member of the cytokine receptor family. Upon erythropoietin binding, this receptor activates Jak2 tyrosine kinase which activates different intracellular pathways including: Ras/MAP kinase, phosphatidylinositol 3-kinase and STAT transcription factors. The stimulated erythropoietin receptor appears to have a role in erythroid cell survival. Defects in the erythropoietin receptor may produce erythroleukemia and familial erythrocytosis. Dysregulation of this gene may affect the growth of certain tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(13857) erythropoietin receptor
Rat(24336) erythropoietin receptor
Zebrafish(751109) erythropoietin receptor
cow(281144) erythropoietin receptor
domestic cat(101081364) erythropoietin receptor
dog(484943) erythropoietin receptor
sheep(443227) erythropoietin receptor
naked mole-rat(101710668) erythropoietin receptor
domestic guinea pig(100721190) erythropoietin receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000121 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU020191 MISSION® esiRNA esiRNA targeting mouse Epor (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000121 Rosetta Predictions human pricing
NM_017002 Rosetta Predictions rat pricing
NM_010149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130351 predicted 266
2 SASI_Hs02_00301909 predicted 1114
3 SASI_Hs01_00130352 predicted 356
4 SASI_Hs01_00130357 predicted 702
5 SASI_Hs01_00130358 predicted 387
6 SASI_Hs02_00301910 predicted 551
7 SASI_Hs01_00130359 predicted 522
8 SASI_Hs02_00301911 predicted 1356
9 SASI_Hs01_00130360 predicted 368
10 SASI_Hs02_00301912 predicted 1035
11 SASI_Hs01_00130353 predicted 1491
12 SASI_Hs01_00130354 predicted 1600
13 SASI_Hs01_00130355 predicted 1516
14 SASI_Hs01_00130356 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097328 predicted 1254
2 SASI_Rn01_00097330 predicted 717
3 SASI_Rn01_00097331 predicted 1459
4 SASI_Rn01_00097332 predicted 1167
5 SASI_Rn01_00097333 predicted 925
6 SASI_Rn01_00097334 predicted 1058
7 SASI_Rn02_00261151 predicted 1253
8 SASI_Rn02_00261152 predicted 1175
9 SASI_Rn01_00097335 predicted 982
10 SASI_Rn01_00097336 predicted 782
11 SASI_Rn01_00097329 predicted 477
12 SASI_Rn01_00097337 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160617 predicted 1238
2 SASI_Mm01_00160618 predicted 1306
3 SASI_Mm01_00160620 predicted 875
4 SASI_Mm01_00160621 predicted 1526
5 SASI_Mm02_00317896 predicted 1005
6 SASI_Mm01_00160623 predicted 356
7 SASI_Mm01_00160624 predicted 1515
8 SASI_Mm01_00160625 predicted 1394
9 SASI_Mm01_00160626 predicted 1320
10 SASI_Mm02_00317897 predicted 373
11 SASI_Mm01_00160619 predicted 324
12 SASI_Mm01_00160622 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010149
EPOR MISSION shRNA Bacterial Glycerol Stock
erythropoietin receptor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010149.3-1507s21c1
Sequence:CCGGATACCTTGTGGTGTCCGATTCCTCGAGGAATCGGACACCACAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010149.3-390s21c1
Sequence:CCGGTCGAGGGTGAGTCACGAAAGTCTCGAGACTTTCGTGACTCACCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010149.3-471s21c1
Sequence:CCGGCAACAGCGGACACATCGAGTTCTCGAGAACTCGATGTGTCCGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-1269s1c1
Sequence:CCGGCCAGGACACCTACTTGGTATTCTCGAGAATACCAAGTAGGTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-1565s1c1
Sequence:CCGGGCATCTCAACAGATTACAGTTCTCGAGAACTGTAATCTGTTGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010149.2-1708s1c1
Sequence:CCGGTCCAGCCTACAACGTCTTGAACTCGAGTTCAAGACGTTGTAGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-580s1c1
Sequence:CCGGCGCATCATCCATATCAATGAACTCGAGTTCATTGATATGGATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-347s1c1
Sequence:CCGGGCTTGGAAGACTTGGTGTGTTCTCGAGAACACACCAAGTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010149
EPOR MISSION shRNA shRNA Plasmid DNA
erythropoietin receptor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010149.3-1507s21c1
Sequence:CCGGATACCTTGTGGTGTCCGATTCCTCGAGGAATCGGACACCACAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010149.3-390s21c1
Sequence:CCGGTCGAGGGTGAGTCACGAAAGTCTCGAGACTTTCGTGACTCACCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010149.3-471s21c1
Sequence:CCGGCAACAGCGGACACATCGAGTTCTCGAGAACTCGATGTGTCCGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-1269s1c1
Sequence:CCGGCCAGGACACCTACTTGGTATTCTCGAGAATACCAAGTAGGTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-1565s1c1
Sequence:CCGGGCATCTCAACAGATTACAGTTCTCGAGAACTGTAATCTGTTGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010149.2-1708s1c1
Sequence:CCGGTCCAGCCTACAACGTCTTGAACTCGAGTTCAAGACGTTGTAGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-580s1c1
Sequence:CCGGCGCATCATCCATATCAATGAACTCGAGTTCATTGATATGGATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-347s1c1
Sequence:CCGGGCTTGGAAGACTTGGTGTGTTCTCGAGAACACACCAAGTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010149
EPOR MISSION shRNA Lentiviral Transduction Particles
erythropoietin receptor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010149.3-1507s21c1
Sequence:CCGGATACCTTGTGGTGTCCGATTCCTCGAGGAATCGGACACCACAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010149.3-390s21c1
Sequence:CCGGTCGAGGGTGAGTCACGAAAGTCTCGAGACTTTCGTGACTCACCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010149.3-471s21c1
Sequence:CCGGCAACAGCGGACACATCGAGTTCTCGAGAACTCGATGTGTCCGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-1269s1c1
Sequence:CCGGCCAGGACACCTACTTGGTATTCTCGAGAATACCAAGTAGGTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-1565s1c1
Sequence:CCGGGCATCTCAACAGATTACAGTTCTCGAGAACTGTAATCTGTTGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010149.2-1708s1c1
Sequence:CCGGTCCAGCCTACAACGTCTTGAACTCGAGTTCAAGACGTTGTAGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-580s1c1
Sequence:CCGGCGCATCATCCATATCAATGAACTCGAGTTCATTGATATGGATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010149.2-347s1c1
Sequence:CCGGGCTTGGAAGACTTGGTGTGTTCTCGAGAACACACCAAGTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000121
EPOR MISSION shRNA Bacterial Glycerol Stock
erythropoietin receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000121.2-1050s21c1
Sequence:CCGGAGCTGTGGCTGTACCAGAATGCTCGAGCATTCTGGTACAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000121.2-1678s21c1
Sequence:CCGGGATGATCAGGGATCCAATATGCTCGAGCATATTGGATCCCTGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000121.2-1643s21c1
Sequence:CCGGAGCTATGTGGCTTGCTCTTAGCTCGAGCTAAGAGCAAGCCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-539s1c1
Sequence:CCGGCGTGTCATCCACATCAATGAACTCGAGTTCATTGATGTGGATGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-995s1c1
Sequence:CCGGCCGAGCCCAGAGAGCGAGTTTCTCGAGAAACTCGCTCTCTGGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-1597s1c1
Sequence:CCGGCCCTTATGAGAACAGCCTTATCTCGAGATAAGGCTGTTCTCATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-1487s1c1
Sequence:CCGGCACCTAAAGTACCTGTACCTTCTCGAGAAGGTACAGGTACTTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-1399s1c1
Sequence:CCGGTGCCAGCTTTGAGTACACTATCTCGAGATAGTGTACTCAAAGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000121
EPOR MISSION shRNA shRNA Plasmid DNA
erythropoietin receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000121.2-1050s21c1
Sequence:CCGGAGCTGTGGCTGTACCAGAATGCTCGAGCATTCTGGTACAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000121.2-1678s21c1
Sequence:CCGGGATGATCAGGGATCCAATATGCTCGAGCATATTGGATCCCTGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000121.2-1643s21c1
Sequence:CCGGAGCTATGTGGCTTGCTCTTAGCTCGAGCTAAGAGCAAGCCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-539s1c1
Sequence:CCGGCGTGTCATCCACATCAATGAACTCGAGTTCATTGATGTGGATGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-995s1c1
Sequence:CCGGCCGAGCCCAGAGAGCGAGTTTCTCGAGAAACTCGCTCTCTGGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-1597s1c1
Sequence:CCGGCCCTTATGAGAACAGCCTTATCTCGAGATAAGGCTGTTCTCATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-1487s1c1
Sequence:CCGGCACCTAAAGTACCTGTACCTTCTCGAGAAGGTACAGGTACTTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-1399s1c1
Sequence:CCGGTGCCAGCTTTGAGTACACTATCTCGAGATAGTGTACTCAAAGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000121
EPOR MISSION shRNA Lentiviral Transduction Particles
erythropoietin receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000121.2-1050s21c1
Sequence:CCGGAGCTGTGGCTGTACCAGAATGCTCGAGCATTCTGGTACAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000121.2-1678s21c1
Sequence:CCGGGATGATCAGGGATCCAATATGCTCGAGCATATTGGATCCCTGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000121.2-1643s21c1
Sequence:CCGGAGCTATGTGGCTTGCTCTTAGCTCGAGCTAAGAGCAAGCCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-539s1c1
Sequence:CCGGCGTGTCATCCACATCAATGAACTCGAGTTCATTGATGTGGATGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-995s1c1
Sequence:CCGGCCGAGCCCAGAGAGCGAGTTTCTCGAGAAACTCGCTCTCTGGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-1597s1c1
Sequence:CCGGCCCTTATGAGAACAGCCTTATCTCGAGATAAGGCTGTTCTCATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-1487s1c1
Sequence:CCGGCACCTAAAGTACCTGTACCTTCTCGAGAAGGTACAGGTACTTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000121.2-1399s1c1
Sequence:CCGGTGCCAGCTTTGAGTACACTATCTCGAGATAGTGTACTCAAAGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks