EMAIL THIS PAGE TO A FRIEND

EPPIN

epididymal peptidase inhibitor

198 Gene Product Result for
Synonyms: CT71 CT72 SPINLW1 WAP7 WFDC7 dJ461P17.2
UniProtKB ID: O95925, A6PVD6, Q86TP9, Q96SD7, Q9HD30
Gene ID:
Human(57119) Summary: This gene encodes an epididymal protease inhibitor, which contains both kunitz-type and WAP-type four-disulfide core (WFDC) protease inhibitor consensus sequences. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene is a member of the WFDC gene family and belongs to the telomeric cluster. The protein can inhibit human sperm motility, and polymorphisms in this gene are associated with male infertility. Read-through transcription also exists between this gene and the downstream WFDC6 (WAP four-disulfide core domain 6) gene. [provided by RefSeq, Nov 2010]
Mouse(75526) epididymal peptidase inhibitor
Rat(685161) epididymal peptidase inhibitor
domestic guinea pig(100725729) epididymal peptidase inhibitor
sheep(101114042) epididymal peptidase inhibitor
domestic cat(101087913) epididymal peptidase inhibitor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300889 Anti-SPINLW1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
WH0057119M2 Monoclonal Anti-SPINLW1 antibody produced in mouse clone 4G3, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020398 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020398 Rosetta Predictions human pricing
NM_181502 Rosetta Predictions human pricing
NM_001109457 Rosetta Predictions rat pricing
NM_029325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133519 predicted 709
2 SASI_Hs01_00133520 predicted 406
3 SASI_Hs01_00133521 predicted 392
4 SASI_Hs02_00353380 predicted 520
5 SASI_Hs01_00133523 predicted 568
6 SASI_Hs01_00133524 predicted 325
7 SASI_Hs01_00133525 predicted 470
8 SASI_Hs01_00133527 predicted 427
9 SASI_Hs02_00353381 predicted 550
10 SASI_Hs01_00133528 predicted 678
11 SASI_Hs01_00133522 predicted 331
12 SASI_Hs01_00133526 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193105 predicted 1190
2 SASI_Hs01_00193106 predicted 898
3 SASI_Hs01_00193107 predicted 882
4 SASI_Hs02_00370119 predicted 999
5 SASI_Hs01_00193109 predicted 1049
6 SASI_Hs01_00193110 predicted 808
7 SASI_Hs01_00193111 predicted 946
8 SASI_Hs01_00193113 predicted 916
9 SASI_Hs02_00370120 predicted 1025
10 SASI_Hs01_00193114 predicted 1155
11 SASI_Hs01_00193108 predicted 813
12 SASI_Hs01_00193112 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248597 predicted 205
2 SASI_Rn02_00248598 predicted 211
3 SASI_Rn02_00248599 predicted 201
4 SASI_Rn02_00248600 predicted 181
5 SASI_Rn02_00248601 predicted 491
6 SASI_Rn02_00248602 predicted 117
7 SASI_Rn02_00248603 predicted 83
8 SASI_Rn02_00248604 predicted 353
9 SASI_Rn02_00248605 predicted 691
10 SASI_Rn02_00248606 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044606 predicted 201
2 SASI_Mm01_00044607 predicted 207
3 SASI_Mm01_00044608 predicted 201
4 SASI_Mm01_00044609 predicted 212
5 SASI_Mm01_00044610 predicted 202
6 SASI_Mm02_00335138 predicted 320
7 SASI_Mm01_00044611 predicted 111
8 SASI_Mm01_00044612 predicted 688
9 SASI_Mm01_00044613 predicted 715
10 SASI_Mm01_00044615 predicted 357
11 SASI_Mm01_00044614 predicted 164
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029325
EPPIN MISSION shRNA Bacterial Glycerol Stock
epididymal peptidase inhibitor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029325.1-562s1c1
Sequence:CCGGCACTGCAAGACCTTGAGTCTTCTCGAGAAGACTCAAGGTCTTGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-225s1c1
Sequence:CCGGGAAAGAGAAGTGCTGTGTCTTCTCGAGAAGACACAGCACTTCTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-331s1c1
Sequence:CCGGCGTTGGTGGTTTAATAAAGAACTCGAGTTCTTTATTAAACCACCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-358s1c1
Sequence:CCGGACGTGCCAAGTCTTCATCTATCTCGAGATAGATGAAGACTTGGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-306s1c1
Sequence:CCGGCGGCTACTGTATGGCTTACTTCTCGAGAAGTAAGCCATACAGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-123s21c1
Sequence:CCGGGTCTAGCTGACTTGCTGTTTCCTCGAGGAAACAGCAAGTCAGCTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-178s21c1
Sequence:CCGGACACCAAGAGAGGGACCTTTGCTCGAGCAAAGGTCCCTCTCTTGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-88s21c1
Sequence:CCGGGCTATTTGGCCTGCTTGCAAGCTCGAGCTTGCAAGCAGGCCAAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-279s21c1
Sequence:CCGGATATCTGCAGCCTGCCGAAAGCTCGAGCTTTCGGCAGGCTGCAGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029325
EPPIN MISSION shRNA shRNA Plasmid DNA
epididymal peptidase inhibitor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029325.1-562s1c1
Sequence:CCGGCACTGCAAGACCTTGAGTCTTCTCGAGAAGACTCAAGGTCTTGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-225s1c1
Sequence:CCGGGAAAGAGAAGTGCTGTGTCTTCTCGAGAAGACACAGCACTTCTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-331s1c1
Sequence:CCGGCGTTGGTGGTTTAATAAAGAACTCGAGTTCTTTATTAAACCACCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-358s1c1
Sequence:CCGGACGTGCCAAGTCTTCATCTATCTCGAGATAGATGAAGACTTGGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-306s1c1
Sequence:CCGGCGGCTACTGTATGGCTTACTTCTCGAGAAGTAAGCCATACAGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-123s21c1
Sequence:CCGGGTCTAGCTGACTTGCTGTTTCCTCGAGGAAACAGCAAGTCAGCTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-178s21c1
Sequence:CCGGACACCAAGAGAGGGACCTTTGCTCGAGCAAAGGTCCCTCTCTTGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-88s21c1
Sequence:CCGGGCTATTTGGCCTGCTTGCAAGCTCGAGCTTGCAAGCAGGCCAAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-279s21c1
Sequence:CCGGATATCTGCAGCCTGCCGAAAGCTCGAGCTTTCGGCAGGCTGCAGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029325
EPPIN MISSION shRNA Lentiviral Transduction Particles
epididymal peptidase inhibitor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029325.1-562s1c1
Sequence:CCGGCACTGCAAGACCTTGAGTCTTCTCGAGAAGACTCAAGGTCTTGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-225s1c1
Sequence:CCGGGAAAGAGAAGTGCTGTGTCTTCTCGAGAAGACACAGCACTTCTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-331s1c1
Sequence:CCGGCGTTGGTGGTTTAATAAAGAACTCGAGTTCTTTATTAAACCACCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-358s1c1
Sequence:CCGGACGTGCCAAGTCTTCATCTATCTCGAGATAGATGAAGACTTGGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029325.1-306s1c1
Sequence:CCGGCGGCTACTGTATGGCTTACTTCTCGAGAAGTAAGCCATACAGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-123s21c1
Sequence:CCGGGTCTAGCTGACTTGCTGTTTCCTCGAGGAAACAGCAAGTCAGCTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-178s21c1
Sequence:CCGGACACCAAGAGAGGGACCTTTGCTCGAGCAAAGGTCCCTCTCTTGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-88s21c1
Sequence:CCGGGCTATTTGGCCTGCTTGCAAGCTCGAGCTTGCAAGCAGGCCAAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029325.2-279s21c1
Sequence:CCGGATATCTGCAGCCTGCCGAAAGCTCGAGCTTTCGGCAGGCTGCAGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020398
EPPIN MISSION shRNA Bacterial Glycerol Stock
epididymal peptidase inhibitor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-408s1c1
Sequence:CCGGACCTGCAAGAATAAACGCTTTCTCGAGAAAGCGTTTATTCTTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-247s1c1
Sequence:CCGGTCAAACAAGATGTATGCGAAACTCGAGTTTCGCATACATCTTGTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-309s1c1
Sequence:CCGGTGGTGGTATGACAAGAAAGATCTCGAGATCTTTCTTGTCATACCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-362s1c1
Sequence:CCGGCCAGGGAAACAATAACAACTTCTCGAGAAGTTGTTATTGTTTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020398.2-1258s1c1
Sequence:CCGGGCTGCACCTATCAACCCATTACTCGAGTAATGGGTTGATAGGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020398.2-687s21c1
Sequence:CCGGATACCTGTGTCACTCTCAATTCTCGAGAATTGAGAGTGACACAGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020398.2-97s21c1
Sequence:CCGGCTGGTCTGACTGATTGGTTATCTCGAGATAACCAATCAGTCAGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020398.2-782s21c1
Sequence:CCGGTTGCAGAGTAAGGGATCATTGCTCGAGCAATGATCCCTTACTCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020398
EPPIN MISSION shRNA shRNA Plasmid DNA
epididymal peptidase inhibitor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-408s1c1
Sequence:CCGGACCTGCAAGAATAAACGCTTTCTCGAGAAAGCGTTTATTCTTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-247s1c1
Sequence:CCGGTCAAACAAGATGTATGCGAAACTCGAGTTTCGCATACATCTTGTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-309s1c1
Sequence:CCGGTGGTGGTATGACAAGAAAGATCTCGAGATCTTTCTTGTCATACCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-362s1c1
Sequence:CCGGCCAGGGAAACAATAACAACTTCTCGAGAAGTTGTTATTGTTTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020398.2-1258s1c1
Sequence:CCGGGCTGCACCTATCAACCCATTACTCGAGTAATGGGTTGATAGGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020398.2-687s21c1
Sequence:CCGGATACCTGTGTCACTCTCAATTCTCGAGAATTGAGAGTGACACAGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020398.2-97s21c1
Sequence:CCGGCTGGTCTGACTGATTGGTTATCTCGAGATAACCAATCAGTCAGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020398.2-782s21c1
Sequence:CCGGTTGCAGAGTAAGGGATCATTGCTCGAGCAATGATCCCTTACTCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020398
EPPIN MISSION shRNA Lentiviral Transduction Particles
epididymal peptidase inhibitor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-408s1c1
Sequence:CCGGACCTGCAAGAATAAACGCTTTCTCGAGAAAGCGTTTATTCTTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-247s1c1
Sequence:CCGGTCAAACAAGATGTATGCGAAACTCGAGTTTCGCATACATCTTGTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-309s1c1
Sequence:CCGGTGGTGGTATGACAAGAAAGATCTCGAGATCTTTCTTGTCATACCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020398.2-362s1c1
Sequence:CCGGCCAGGGAAACAATAACAACTTCTCGAGAAGTTGTTATTGTTTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020398.2-1258s1c1
Sequence:CCGGGCTGCACCTATCAACCCATTACTCGAGTAATGGGTTGATAGGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020398.2-687s21c1
Sequence:CCGGATACCTGTGTCACTCTCAATTCTCGAGAATTGAGAGTGACACAGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020398.2-97s21c1
Sequence:CCGGCTGGTCTGACTGATTGGTTATCTCGAGATAACCAATCAGTCAGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020398.2-782s21c1
Sequence:CCGGTTGCAGAGTAAGGGATCATTGCTCGAGCAATGATCCCTTACTCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)