EMAIL THIS PAGE TO A FRIEND

EPPK1

epiplakin 1

41 Gene Product Result for
Synonyms: EPIPL EPIPL1
UniProtKB ID: P58107, Q76E58
Gene ID:
Mouse(223650) epiplakin 1
Rat(680860) epiplakin 1
sheep(101116485) epiplakin 1
Zebrafish(368210) epiplakin 1
cow(524939) epiplakin 1
cow(100337278) epiplakin 1
dog(475117) epiplakin 1
chicken(429489) epiplakin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031308 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031308 Rosetta Predictions human pricing
XM_001059215 Rosetta Predictions rat pricing
NM_144848 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151372 predicted 5490
2 SASI_Hs01_00151373 predicted 409
3 SASI_Hs01_00151374 predicted 3201
4 SASI_Hs01_00151375 predicted 6389
5 SASI_Hs01_00151376 predicted 5338
6 SASI_Hs01_00151378 predicted 6515
7 SASI_Hs02_00358755 predicted 6359
8 SASI_Hs01_00151379 predicted 4428
9 SASI_Hs01_00151380 predicted 2025
10 SASI_Hs01_00151381 predicted 6533
11 SASI_Hs01_00151377 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292454 predicted 5282
2 SASI_Rn02_00292455 predicted 1457
3 SASI_Rn02_00292456 predicted 3961
4 SASI_Rn02_00292457 predicted 430
5 SASI_Rn02_00292458 predicted 7893
6 SASI_Rn02_00292459 predicted 1575
7 SASI_Rn02_00292460 predicted 3030
8 SASI_Rn02_00292461 predicted 2952
9 SASI_Rn02_00292462 predicted 630
10 SASI_Rn02_00292463 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340249 predicted 7563
2 SASI_Mm02_00340250 predicted 1318
3 SASI_Mm02_00340251 predicted 6017
4 SASI_Mm02_00340252 predicted 3164
5 SASI_Mm02_00340253 predicted 20687
6 SASI_Mm02_00340254 predicted 2355
7 SASI_Mm02_00340255 predicted 5039
8 SASI_Mm02_00340256 predicted 1208
9 SASI_Mm02_00340257 predicted 8756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144848
EPPK1 MISSION shRNA Bacterial Glycerol Stock
epiplakin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144848.2-21455s1c1
Sequence:CCGGGCCCTCTGTGTTAGGAATAATCTCGAGATTATTCCTAACACAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-7631s1c1
Sequence:CCGGCCTACAAATGATTGCAGACAACTCGAGTTGTCTGCAATCATTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-2596s1c1
Sequence:CCGGCCACATTTATTGATCACTGTACTCGAGTACAGTGATCAATAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-1560s1c1
Sequence:CCGGGCCATCAAGAAAGAAGTTGTACTCGAGTACAACTTCTTTCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-6018s1c1
Sequence:CCGGCGGAAGCTAACTGTAGAGCAACTCGAGTTGCTCTACAGTTAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144848
EPPK1 MISSION shRNA shRNA Plasmid DNA
epiplakin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144848.2-21455s1c1
Sequence:CCGGGCCCTCTGTGTTAGGAATAATCTCGAGATTATTCCTAACACAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-7631s1c1
Sequence:CCGGCCTACAAATGATTGCAGACAACTCGAGTTGTCTGCAATCATTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-2596s1c1
Sequence:CCGGCCACATTTATTGATCACTGTACTCGAGTACAGTGATCAATAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-1560s1c1
Sequence:CCGGGCCATCAAGAAAGAAGTTGTACTCGAGTACAACTTCTTTCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-6018s1c1
Sequence:CCGGCGGAAGCTAACTGTAGAGCAACTCGAGTTGCTCTACAGTTAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144848
EPPK1 MISSION shRNA Lentiviral Transduction Particles
epiplakin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144848.2-21455s1c1
Sequence:CCGGGCCCTCTGTGTTAGGAATAATCTCGAGATTATTCCTAACACAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-7631s1c1
Sequence:CCGGCCTACAAATGATTGCAGACAACTCGAGTTGTCTGCAATCATTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-2596s1c1
Sequence:CCGGCCACATTTATTGATCACTGTACTCGAGTACAGTGATCAATAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-1560s1c1
Sequence:CCGGGCCATCAAGAAAGAAGTTGTACTCGAGTACAACTTCTTTCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144848.2-6018s1c1
Sequence:CCGGCGGAAGCTAACTGTAGAGCAACTCGAGTTGCTCTACAGTTAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031308
EPPK1 MISSION shRNA Bacterial Glycerol Stock
epiplakin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-4915s1c1
Sequence:CCGGCGGGAAAGAAACCTACGTGAACTCGAGTTCACGTAGGTTTCTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-6535s1c1
Sequence:CCGGCCAAGGAATTAGACGACAGATCTCGAGATCTGTCGTCTAATTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-2471s1c1
Sequence:CCGGTCCGTGAAGTATGGACGGTTTCTCGAGAAACCGTCCATACTTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031308.1-15332s1c1
Sequence:CCGGGCATACTTGTGTGTCTGGGTTCTCGAGAACCCAGACACACAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-5278s1c1
Sequence:CCGGCCTGCTACAAATCATAAAGAACTCGAGTTCTTTATGATTTGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031308
EPPK1 MISSION shRNA shRNA Plasmid DNA
epiplakin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-4915s1c1
Sequence:CCGGCGGGAAAGAAACCTACGTGAACTCGAGTTCACGTAGGTTTCTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-6535s1c1
Sequence:CCGGCCAAGGAATTAGACGACAGATCTCGAGATCTGTCGTCTAATTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-2471s1c1
Sequence:CCGGTCCGTGAAGTATGGACGGTTTCTCGAGAAACCGTCCATACTTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031308.1-15332s1c1
Sequence:CCGGGCATACTTGTGTGTCTGGGTTCTCGAGAACCCAGACACACAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-5278s1c1
Sequence:CCGGCCTGCTACAAATCATAAAGAACTCGAGTTCTTTATGATTTGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031308
EPPK1 MISSION shRNA Lentiviral Transduction Particles
epiplakin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-4915s1c1
Sequence:CCGGCGGGAAAGAAACCTACGTGAACTCGAGTTCACGTAGGTTTCTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-6535s1c1
Sequence:CCGGCCAAGGAATTAGACGACAGATCTCGAGATCTGTCGTCTAATTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-2471s1c1
Sequence:CCGGTCCGTGAAGTATGGACGGTTTCTCGAGAAACCGTCCATACTTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031308.1-15332s1c1
Sequence:CCGGGCATACTTGTGTGTCTGGGTTCTCGAGAACCCAGACACACAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031308.1-5278s1c1
Sequence:CCGGCCTGCTACAAATCATAAAGAACTCGAGTTCTTTATGATTTGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks