EMAIL THIS PAGE TO A FRIEND

EPRS

glutamyl-prolyl-tRNA synthetase

54 Gene Product Result for
Synonyms: EARS GLUPRORS PARS QARS QPRS
Gene ID:
Human(2058) Summary: Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
Mouse(107508) glutamyl-prolyl-tRNA synthetase
Rat(289352) glutamyl-prolyl-tRNA synthetase
Zebrafish(562037) glutamyl-prolyl-tRNA synthetase
dog(478962) glutamyl-prolyl-tRNA synthetase
domestic cat(101094820) glutamyl-prolyl-tRNA synthetase
cow(538357) glutamyl-prolyl-tRNA synthetase
Horse(100050245) glutamyl-prolyl-tRNA synthetase
chicken(421348) glutamyl-prolyl-tRNA synthetase
naked mole-rat(101708999) glutamyl-prolyl-tRNA synthetase
domestic guinea pig(100714693) glutamyl-prolyl-tRNA synthetase
sheep(101104590) glutamyl-prolyl-tRNA synthetase
Domestic Rabbit(100340173) glutamyl-prolyl-tRNA synthetase
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002081 MISSION® esiRNA esiRNA targeting human EPRS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004446 Rosetta Predictions human pricing
NM_001024238 Rosetta Predictions rat pricing
NM_029735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243968 predicted 4523
2 SASI_Hs01_00243969 predicted 3703
3 SASI_Hs01_00243970 predicted 1131
4 SASI_Hs01_00243971 predicted 459
5 SASI_Hs01_00243972 predicted 2285
6 SASI_Hs01_00243973 predicted 4773
7 SASI_Hs02_00337626 predicted 712
8 SASI_Hs01_00243974 predicted 558
9 SASI_Hs01_00243975 predicted 4106
10 SASI_Hs01_00243976 predicted 4261
11 SASI_Hs01_00243967 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202380 predicted 1634
2 SASI_Rn01_00092992 predicted 341
3 SASI_Rn02_00202381 predicted 1866
4 SASI_Rn01_00092994 predicted 810
5 SASI_Rn01_00092995 predicted 1266
6 SASI_Rn01_00092997 predicted 487
7 SASI_Rn01_00093001 predicted 3474
8 SASI_Rn02_00202382 predicted 2076
9 SASI_Rn02_00202383 predicted 1966
10 SASI_Rn02_00202384 predicted 495
11 SASI_Rn01_00092993 predicted 4177
12 SASI_Rn01_00092996 predicted 4229
13 SASI_Rn01_00092998 predicted 3511
14 SASI_Rn01_00092999 predicted 3751
15 SASI_Rn01_00093000 predicted 4032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134940 predicted 392
2 SASI_Mm01_00134941 predicted 860
3 SASI_Mm01_00134942 predicted 2045
4 SASI_Mm02_00335826 predicted 233
5 SASI_Mm01_00134943 predicted 1327
6 SASI_Mm01_00134944 predicted 325
7 SASI_Mm01_00134945 predicted 538
8 SASI_Mm01_00134946 predicted 209
9 SASI_Mm02_00335827 predicted 4409
10 SASI_Mm01_00134948 predicted 1346
11 SASI_Mm01_00134947 predicted 3450
12 SASI_Mm01_00134949 predicted 4213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004446
VALIDATED
EPRS MISSION shRNA Bacterial Glycerol Stock
glutamyl-prolyl-tRNA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_004446.1-1352s1c1
Sequence:CCGGGCTCCACGATATGTTGCATTACTCGAGTAATGCAACATATCGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004446.1-4121s1c1
Sequence:CCGGGCTAATACAATGGAAGACTTTCTCGAGAAAGTCTTCCATTGTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004446.1-239s1c1
Sequence:CCGGGCCTGGCAAGAACAGTTGAAACTCGAGTTTCAACTGTTCTTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004446.1-902s1c1
Sequence:CCGGCCAACCCTTTATCGCTGCAAACTCGAGTTTGCAGCGATAAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004446.1-2793s1c1
Sequence:CCGGGCCAAAGGAAAGACCCTTCTACTCGAGTAGAAGGGTCTTTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-2321s21c1
Sequence:CCGGATGAACCTGTTAGCCCATATACTCGAGTATATGGGCTAACAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-1330s21c1
Sequence:CCGGCCAACCCTTTATCGCTGCAAACTCGAGTTTGCAGCGATAAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-667s21c1
Sequence:CCGGGCCTGGCAAGAACAGTTGAAACTCGAGTTTCAACTGTTCTTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-4828s21c1
Sequence:CCGGCTCTTCAACTCCTCTCACTTTCTCGAGAAAGTGAGAGGAGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-4774s21c1
Sequence:CCGGGCCAAGTACTACACCTTATTTCTCGAGAAATAAGGTGTAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004446
VALIDATED
EPRS MISSION shRNA shRNA Plasmid DNA
glutamyl-prolyl-tRNA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_004446.1-1352s1c1
Sequence:CCGGGCTCCACGATATGTTGCATTACTCGAGTAATGCAACATATCGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004446.1-4121s1c1
Sequence:CCGGGCTAATACAATGGAAGACTTTCTCGAGAAAGTCTTCCATTGTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004446.1-239s1c1
Sequence:CCGGGCCTGGCAAGAACAGTTGAAACTCGAGTTTCAACTGTTCTTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004446.1-902s1c1
Sequence:CCGGCCAACCCTTTATCGCTGCAAACTCGAGTTTGCAGCGATAAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004446.1-2793s1c1
Sequence:CCGGGCCAAAGGAAAGACCCTTCTACTCGAGTAGAAGGGTCTTTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-2321s21c1
Sequence:CCGGATGAACCTGTTAGCCCATATACTCGAGTATATGGGCTAACAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-1330s21c1
Sequence:CCGGCCAACCCTTTATCGCTGCAAACTCGAGTTTGCAGCGATAAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-667s21c1
Sequence:CCGGGCCTGGCAAGAACAGTTGAAACTCGAGTTTCAACTGTTCTTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-4828s21c1
Sequence:CCGGCTCTTCAACTCCTCTCACTTTCTCGAGAAAGTGAGAGGAGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-4774s21c1
Sequence:CCGGGCCAAGTACTACACCTTATTTCTCGAGAAATAAGGTGTAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004446
VALIDATED
EPRS MISSION shRNA Lentiviral Transduction Particles
glutamyl-prolyl-tRNA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_004446.1-1352s1c1
Sequence:CCGGGCTCCACGATATGTTGCATTACTCGAGTAATGCAACATATCGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004446.1-4121s1c1
Sequence:CCGGGCTAATACAATGGAAGACTTTCTCGAGAAAGTCTTCCATTGTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004446.1-239s1c1
Sequence:CCGGGCCTGGCAAGAACAGTTGAAACTCGAGTTTCAACTGTTCTTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004446.1-902s1c1
Sequence:CCGGCCAACCCTTTATCGCTGCAAACTCGAGTTTGCAGCGATAAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004446.1-2793s1c1
Sequence:CCGGGCCAAAGGAAAGACCCTTCTACTCGAGTAGAAGGGTCTTTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-2321s21c1
Sequence:CCGGATGAACCTGTTAGCCCATATACTCGAGTATATGGGCTAACAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-1330s21c1
Sequence:CCGGCCAACCCTTTATCGCTGCAAACTCGAGTTTGCAGCGATAAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-667s21c1
Sequence:CCGGGCCTGGCAAGAACAGTTGAAACTCGAGTTTCAACTGTTCTTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-4828s21c1
Sequence:CCGGCTCTTCAACTCCTCTCACTTTCTCGAGAAAGTGAGAGGAGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004446.2-4774s21c1
Sequence:CCGGGCCAAGTACTACACCTTATTTCTCGAGAAATAAGGTGTAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029735
VALIDATED
EPRS MISSION shRNA Bacterial Glycerol Stock
glutamyl-prolyl-tRNA synthetase
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-3124s1c1
Sequence:CCGGGCCTAAGAAACAGACCAGATTCTCGAGAATCTGGTCTGTTTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4607s1c1
Sequence:CCGGGCCAAGTTCTACACCTTGTTTCTCGAGAAACAAGGTGTAGAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4695s1c1
Sequence:CCGGGATACGAAGATCTTCTCAGATCTCGAGATCTGAGAAGATCTTCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4699s1c1
Sequence:CCGGCGAAGATCTTCTCAGATGCAACTCGAGTTGCATCTGAGAAGATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4700s1c1
Sequence:CCGGGAAGATCTTCTCAGATGCAATCTCGAGATTGCATCTGAGAAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029735.1-4607s21c1
Sequence:CCGGGCCAAGTTCTACACCTTGTTTCTCGAGAAACAAGGTGTAGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029735.1-2155s21c1
Sequence:CCGGCGAACCTGTCAGCCCATATAGCTCGAGCTATATGGGCTGACAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-325s1c1
Sequence:CCGGGCACACTGAGATTGATCATTGCTCGAGCAATGATCAATCTCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-1817s1c1
Sequence:CCGGGGCAACATCAACATTACTAAACTCGAGTTTAGTAATGTTGATGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-869s1c1
Sequence:CCGGGTTGCAATGCTGCATATTAAACTCGAGTTTAATATGCAGCATTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-1330s1c1
Sequence:CCGGCATTGAAGCTTTAGGCATAAGCTCGAGCTTATGCCTAAAGCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029735.1-4695s21c1
Sequence:CCGGGATACGAAGATCTTCTCAGATCTCGAGATCTGAGAAGATCTTCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029735.1-2934s21c1
Sequence:CCGGCGCTGACAGGAATCGAGTATACTCGAGTATACTCGATTCCTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029735
VALIDATED
EPRS MISSION shRNA shRNA Plasmid DNA
glutamyl-prolyl-tRNA synthetase
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-3124s1c1
Sequence:CCGGGCCTAAGAAACAGACCAGATTCTCGAGAATCTGGTCTGTTTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4607s1c1
Sequence:CCGGGCCAAGTTCTACACCTTGTTTCTCGAGAAACAAGGTGTAGAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4695s1c1
Sequence:CCGGGATACGAAGATCTTCTCAGATCTCGAGATCTGAGAAGATCTTCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4699s1c1
Sequence:CCGGCGAAGATCTTCTCAGATGCAACTCGAGTTGCATCTGAGAAGATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4700s1c1
Sequence:CCGGGAAGATCTTCTCAGATGCAATCTCGAGATTGCATCTGAGAAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029735.1-4607s21c1
Sequence:CCGGGCCAAGTTCTACACCTTGTTTCTCGAGAAACAAGGTGTAGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029735.1-2155s21c1
Sequence:CCGGCGAACCTGTCAGCCCATATAGCTCGAGCTATATGGGCTGACAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-325s1c1
Sequence:CCGGGCACACTGAGATTGATCATTGCTCGAGCAATGATCAATCTCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-1817s1c1
Sequence:CCGGGGCAACATCAACATTACTAAACTCGAGTTTAGTAATGTTGATGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-869s1c1
Sequence:CCGGGTTGCAATGCTGCATATTAAACTCGAGTTTAATATGCAGCATTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-1330s1c1
Sequence:CCGGCATTGAAGCTTTAGGCATAAGCTCGAGCTTATGCCTAAAGCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029735.1-4695s21c1
Sequence:CCGGGATACGAAGATCTTCTCAGATCTCGAGATCTGAGAAGATCTTCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029735.1-2934s21c1
Sequence:CCGGCGCTGACAGGAATCGAGTATACTCGAGTATACTCGATTCCTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029735
VALIDATED
EPRS MISSION shRNA Lentiviral Transduction Particles
glutamyl-prolyl-tRNA synthetase
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-3124s1c1
Sequence:CCGGGCCTAAGAAACAGACCAGATTCTCGAGAATCTGGTCTGTTTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4607s1c1
Sequence:CCGGGCCAAGTTCTACACCTTGTTTCTCGAGAAACAAGGTGTAGAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4695s1c1
Sequence:CCGGGATACGAAGATCTTCTCAGATCTCGAGATCTGAGAAGATCTTCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4699s1c1
Sequence:CCGGCGAAGATCTTCTCAGATGCAACTCGAGTTGCATCTGAGAAGATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029735.1-4700s1c1
Sequence:CCGGGAAGATCTTCTCAGATGCAATCTCGAGATTGCATCTGAGAAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029735.1-4607s21c1
Sequence:CCGGGCCAAGTTCTACACCTTGTTTCTCGAGAAACAAGGTGTAGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029735.1-2155s21c1
Sequence:CCGGCGAACCTGTCAGCCCATATAGCTCGAGCTATATGGGCTGACAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-325s1c1
Sequence:CCGGGCACACTGAGATTGATCATTGCTCGAGCAATGATCAATCTCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-1817s1c1
Sequence:CCGGGGCAACATCAACATTACTAAACTCGAGTTTAGTAATGTTGATGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-869s1c1
Sequence:CCGGGTTGCAATGCTGCATATTAAACTCGAGTTTAATATGCAGCATTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029735.1-1330s1c1
Sequence:CCGGCATTGAAGCTTTAGGCATAAGCTCGAGCTTATGCCTAAAGCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029735.1-4695s21c1
Sequence:CCGGGATACGAAGATCTTCTCAGATCTCGAGATCTGAGAAGATCTTCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029735.1-2934s21c1
Sequence:CCGGCGCTGACAGGAATCGAGTATACTCGAGTATACTCGATTCCTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks