EMAIL THIS PAGE TO A FRIEND

EPS15

epidermal growth factor receptor pathway substrate 15

170 Gene Product Result for
Synonyms: AF-1P AF1P MLLT5
UniProtKB ID: P42566, B2R8J7, D3DPJ2, Q5SRH4
Gene ID:
Human(2060) Summary: This gene encodes a protein that is part of the EGFR pathway. The protein is present at clatherin-coated pits and is involved in receptor-mediated endocytosis of EGF. Notably, this gene is rearranged with the HRX/ALL/MLL gene in acute myelogeneous leukemias. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2009]
Mouse(13858) epidermal growth factor receptor pathway substrate 15
Rat(313474) epidermal growth factor receptor pathway substrate 15
Zebrafish(795505) epidermal growth factor receptor pathway substrate 15
chicken(424633) epidermal growth factor receptor pathway substrate 15
dog(475356) epidermal growth factor receptor pathway substrate 15
domestic cat(101087853) epidermal growth factor receptor pathway substrate 15
Horse(100062532) epidermal growth factor receptor pathway substrate 15
cow(535998) epidermal growth factor receptor pathway substrate 15
sheep(101110462) epidermal growth factor receptor pathway substrate 15
Domestic Rabbit(100350663) epidermal growth factor receptor pathway substrate 15
domestic guinea pig(100721481) epidermal growth factor receptor pathway substrate 15
naked mole-rat(101718798) epidermal growth factor receptor pathway substrate 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001981 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001981 Rosetta Predictions human pricing
NM_001009424 Rosetta Predictions rat pricing
NM_007943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159213 predicted 1699
2 SASI_Hs01_00159214 predicted 1081
3 SASI_Hs01_00159215 predicted 1214
4 SASI_Hs01_00159216 predicted 824
5 SASI_Hs01_00159217 predicted 1082
6 SASI_Hs01_00159218 predicted 1050
7 SASI_Hs01_00159219 predicted 2573
8 SASI_Hs01_00159220 predicted 1468
9 SASI_Hs01_00159221 predicted 1181
10 SASI_Hs01_00159222 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116381 predicted 639
2 SASI_Rn02_00199532 predicted 1264
3 SASI_Rn02_00199533 predicted 1846
4 SASI_Rn01_00116383 predicted 1936
5 SASI_Rn01_00116384 predicted 1103
6 SASI_Rn01_00116385 predicted 353
7 SASI_Rn01_00116386 predicted 2151
8 SASI_Rn01_00116387 predicted 956
9 SASI_Rn01_00116388 predicted 594
10 SASI_Rn01_00116389 predicted 522
11 SASI_Rn01_00116382 predicted 1609
12 SASI_Rn01_00116390 predicted 2062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140190 predicted 1229
2 SASI_Mm01_00140191 predicted 1116
3 SASI_Mm01_00140192 predicted 2487
4 SASI_Mm01_00140193 predicted 1106
5 SASI_Mm01_00140194 predicted 1848
6 SASI_Mm01_00140195 predicted 1776
7 SASI_Mm01_00140196 predicted 1501
8 SASI_Mm01_00140197 predicted 487
9 SASI_Mm01_00140198 predicted 2147
10 SASI_Mm02_00312791 predicted 1565
11 SASI_Mm01_00140189 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001981
VALIDATED
EPS15 MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor receptor pathway substrate 15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-1163s21c1
Sequence:GTACCGGGGAGAAGGAAGATACTATTAACTCGAGTTAATAGTATCTTCCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-824s21c1
Sequence:GTACCGGTGGATTGGAGGTCCGTGAAATCTCGAGATTTCACGGACCTCCAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-1856s21c1
Sequence:GTACCGGACTCGACAATAATAGACATTCCTCGAGGAATGTCTATTATTGTCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-983s21c1
Sequence:GTACCGGTGATCCTCCTCACGTTCTTACCTCGAGGTAAGAACGTGAGGAGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001981.2-3248s21c1
Sequence:GTACCGGGATTGGTGCAAATTGGCTAAACTCGAGTTTAGCCAATTTGCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001981.1-3094s1c1
Sequence:CCGGCCTTCTGGAATATAGAGAAATCTCGAGATTTCTCTATATTCCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_001981.1-2709s1c1
Sequence:CCGGCGACTAAATCAGCAGGAACAACTCGAGTTGTTCCTGCTGATTTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001981.1-340s1c1
Sequence:CCGGCCCAGAATGGATTGGAAGTTTCTCGAGAAACTTCCAATCCATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001981.1-1690s1c1
Sequence:CCGGGCAGTGAAACAGCCAACCTTACTCGAGTAAGGTTGGCTGTTTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001981.1-2118s1c1
Sequence:CCGGGCAGCCAACAATAGCAGTATTCTCGAGAATACTGCTATTGTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001981
VALIDATED
EPS15 MISSION shRNA shRNA Plasmid DNA
epidermal growth factor receptor pathway substrate 15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-1163s21c1
Sequence:GTACCGGGGAGAAGGAAGATACTATTAACTCGAGTTAATAGTATCTTCCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-824s21c1
Sequence:GTACCGGTGGATTGGAGGTCCGTGAAATCTCGAGATTTCACGGACCTCCAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-1856s21c1
Sequence:GTACCGGACTCGACAATAATAGACATTCCTCGAGGAATGTCTATTATTGTCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-983s21c1
Sequence:GTACCGGTGATCCTCCTCACGTTCTTACCTCGAGGTAAGAACGTGAGGAGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001981.2-3248s21c1
Sequence:GTACCGGGATTGGTGCAAATTGGCTAAACTCGAGTTTAGCCAATTTGCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001981.1-3094s1c1
Sequence:CCGGCCTTCTGGAATATAGAGAAATCTCGAGATTTCTCTATATTCCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_001981.1-2709s1c1
Sequence:CCGGCGACTAAATCAGCAGGAACAACTCGAGTTGTTCCTGCTGATTTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001981.1-340s1c1
Sequence:CCGGCCCAGAATGGATTGGAAGTTTCTCGAGAAACTTCCAATCCATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001981.1-1690s1c1
Sequence:CCGGGCAGTGAAACAGCCAACCTTACTCGAGTAAGGTTGGCTGTTTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001981.1-2118s1c1
Sequence:CCGGGCAGCCAACAATAGCAGTATTCTCGAGAATACTGCTATTGTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001981
VALIDATED
EPS15 MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor receptor pathway substrate 15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-1163s21c1
Sequence:GTACCGGGGAGAAGGAAGATACTATTAACTCGAGTTAATAGTATCTTCCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-824s21c1
Sequence:GTACCGGTGGATTGGAGGTCCGTGAAATCTCGAGATTTCACGGACCTCCAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-1856s21c1
Sequence:GTACCGGACTCGACAATAATAGACATTCCTCGAGGAATGTCTATTATTGTCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001981.2-983s21c1
Sequence:GTACCGGTGATCCTCCTCACGTTCTTACCTCGAGGTAAGAACGTGAGGAGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001981.2-3248s21c1
Sequence:GTACCGGGATTGGTGCAAATTGGCTAAACTCGAGTTTAGCCAATTTGCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001981.1-3094s1c1
Sequence:CCGGCCTTCTGGAATATAGAGAAATCTCGAGATTTCTCTATATTCCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_001981.1-2709s1c1
Sequence:CCGGCGACTAAATCAGCAGGAACAACTCGAGTTGTTCCTGCTGATTTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001981.1-340s1c1
Sequence:CCGGCCCAGAATGGATTGGAAGTTTCTCGAGAAACTTCCAATCCATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001981.1-1690s1c1
Sequence:CCGGGCAGTGAAACAGCCAACCTTACTCGAGTAAGGTTGGCTGTTTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001981.1-2118s1c1
Sequence:CCGGGCAGCCAACAATAGCAGTATTCTCGAGAATACTGCTATTGTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007943
VALIDATED
EPS15 MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor receptor pathway substrate 15
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007943.2-1646s21c1
Sequence:CCGGGCCCACAAAGCGTTCTTGTTACTCGAGTAACAAGAACGCTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007943.2-2877s21c1
Sequence:CCGGCCTATGAGCATGGGATACAAACTCGAGTTTGTATCCCATGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007943.2-2150s21c1
Sequence:CCGGGCAGTAATACATCGGTAGAAACTCGAGTTTCTACCGATGTATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007943.2-2088s21c1
Sequence:CCGGGCAGACTTCTACTGATCCTTTCTCGAGAAAGGATCAGTAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-2879s1c1
Sequence:CCGGCCTATGAGCATGGGATACAAACTCGAGTTTGTATCCCATGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-2485s1c1
Sequence:CCGGCCATCAACAAATTGGATTCTTCTCGAGAAGAATCCAATTTGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-1648s1c1
Sequence:CCGGGCCCACAAAGCGTTCTTGTTACTCGAGTAACAAGAACGCTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-2090s1c1
Sequence:CCGGGCAGACTTCTACTGATCCTTTCTCGAGAAAGGATCAGTAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007943
VALIDATED
EPS15 MISSION shRNA shRNA Plasmid DNA
epidermal growth factor receptor pathway substrate 15
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007943.2-1646s21c1
Sequence:CCGGGCCCACAAAGCGTTCTTGTTACTCGAGTAACAAGAACGCTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007943.2-2877s21c1
Sequence:CCGGCCTATGAGCATGGGATACAAACTCGAGTTTGTATCCCATGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007943.2-2150s21c1
Sequence:CCGGGCAGTAATACATCGGTAGAAACTCGAGTTTCTACCGATGTATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007943.2-2088s21c1
Sequence:CCGGGCAGACTTCTACTGATCCTTTCTCGAGAAAGGATCAGTAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-2879s1c1
Sequence:CCGGCCTATGAGCATGGGATACAAACTCGAGTTTGTATCCCATGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-2485s1c1
Sequence:CCGGCCATCAACAAATTGGATTCTTCTCGAGAAGAATCCAATTTGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-1648s1c1
Sequence:CCGGGCCCACAAAGCGTTCTTGTTACTCGAGTAACAAGAACGCTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-2090s1c1
Sequence:CCGGGCAGACTTCTACTGATCCTTTCTCGAGAAAGGATCAGTAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007943
VALIDATED
EPS15 MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor receptor pathway substrate 15
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007943.2-1646s21c1
Sequence:CCGGGCCCACAAAGCGTTCTTGTTACTCGAGTAACAAGAACGCTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007943.2-2877s21c1
Sequence:CCGGCCTATGAGCATGGGATACAAACTCGAGTTTGTATCCCATGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007943.2-2150s21c1
Sequence:CCGGGCAGTAATACATCGGTAGAAACTCGAGTTTCTACCGATGTATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007943.2-2088s21c1
Sequence:CCGGGCAGACTTCTACTGATCCTTTCTCGAGAAAGGATCAGTAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-2879s1c1
Sequence:CCGGCCTATGAGCATGGGATACAAACTCGAGTTTGTATCCCATGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-2485s1c1
Sequence:CCGGCCATCAACAAATTGGATTCTTCTCGAGAAGAATCCAATTTGTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-1648s1c1
Sequence:CCGGGCCCACAAAGCGTTCTTGTTACTCGAGTAACAAGAACGCTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007943.1-2090s1c1
Sequence:CCGGGCAGACTTCTACTGATCCTTTCTCGAGAAAGGATCAGTAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks