EMAIL THIS PAGE TO A FRIEND

EPS15L1

epidermal growth factor receptor pathway substrate 15-like 1

Synonyms: EPS15R
UniProtKB ID: Q9UBC2, A2RRF3, A5PL29, B4DKA3
Gene ID:
Mouse(13859) epidermal growth factor receptor pathway substrate 15-like 1
Rat(361120) epidermal growth factor receptor pathway substrate 15-like 1
naked mole-rat(101702336) epidermal growth factor receptor pathway substrate 15-like 1
domestic guinea pig(100729704) epidermal growth factor receptor pathway substrate 15-like 1
sheep(101117929) epidermal growth factor receptor pathway substrate 15-like 1
Domestic Rabbit(100352462) epidermal growth factor receptor pathway substrate 15-like 1
chicken(420147) epidermal growth factor receptor pathway substrate 15-like 1
domestic cat(101093837) epidermal growth factor receptor pathway substrate 15-like 1
cow(506374) epidermal growth factor receptor pathway substrate 15-like 1
Horse(100069848) epidermal growth factor receptor pathway substrate 15-like 1
dog(484849) epidermal growth factor receptor pathway substrate 15-like 1
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021235 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021235 Rosetta Predictions human pricing
NM_001029921 Rosetta Predictions rat pricing
NM_001122832 Rosetta Predictions mouse pricing
NM_007944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018795 predicted 994
2 SASI_Hs01_00018797 predicted 2370
3 SASI_Hs01_00018798 predicted 2047
4 SASI_Hs01_00018799 predicted 1178
5 SASI_Hs01_00018800 predicted 789
6 SASI_Hs01_00018801 predicted 256
7 SASI_Hs01_00018802 predicted 837
8 SASI_Hs01_00018803 predicted 2055
9 SASI_Hs01_00018804 predicted 217
10 SASI_Hs02_00354871 predicted 439
11 SASI_Hs01_00018796 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035182 predicted 1905
2 SASI_Rn01_00035184 predicted 1298
3 SASI_Rn01_00035185 predicted 450
4 SASI_Rn01_00035186 predicted 997
5 SASI_Rn01_00035187 predicted 832
6 SASI_Rn01_00035188 predicted 533
7 SASI_Rn02_00203491 predicted 1142
8 SASI_Rn01_00035189 predicted 520
9 SASI_Rn01_00035190 predicted 419
10 SASI_Rn02_00203492 predicted 880
11 SASI_Rn01_00035181 predicted 850
12 SASI_Rn01_00035183 predicted 1747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309479 predicted 1161
2 SASI_Mm02_00309480 predicted 1139
3 SASI_Mm02_00309481 predicted 568
4 SASI_Mm02_00309482 predicted 217
5 SASI_Mm02_00309483 predicted 288
6 SASI_Mm02_00309484 predicted 849
7 SASI_Mm02_00309485 predicted 1476
8 SASI_Mm02_00309486 predicted 543
9 SASI_Mm02_00309487 predicted 906
10 SASI_Mm02_00309488 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197674 predicted 1157
2 SASI_Mm01_00197675 predicted 1131
3 SASI_Mm02_00312792 predicted 559
4 SASI_Mm02_00312793 predicted 219
5 SASI_Mm01_00197677 predicted 288
6 SASI_Mm01_00197679 predicted 851
7 SASI_Mm01_00197682 predicted 1470
8 SASI_Mm02_00312794 predicted 547
9 SASI_Mm02_00312795 predicted 899
10 SASI_Mm02_00312796 predicted 1013
11 SASI_Mm01_00197676 predicted 1802
12 SASI_Mm01_00197678 predicted 2132
13 SASI_Mm01_00197680 predicted 2780
14 SASI_Mm01_00197681 predicted 2619
15 SASI_Mm01_00197683 predicted 557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007944
VALIDATED
EPS15L1 MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor receptor pathway substrate 15-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007944.1-2781s1c1
Sequence:CCGGCATCCCTTCAAGTTGTGCCATCTCGAGATGGCACAACTTGAAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007944.1-838s1c1
Sequence:CCGGGCAGATAAGATGCGCTTTGATCTCGAGATCAAAGCGCATCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007944.1-1440s1c1
Sequence:CCGGCCAGACAATCTCATCATTGAACTCGAGTTCAATGATGAGATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007944.1-139s1c1
Sequence:CCGGGCTGCGCTGTTTCTGAAGAAACTCGAGTTTCTTCAGAAACAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007944.1-2113s1c1
Sequence:CCGGCCTTCAAAGCTCGACCCATTTCTCGAGAAATGGGTCGAGCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-2535s21c1
Sequence:CCGGTTAGTGGCAAAGATCCATTTGCTCGAGCAAATGGATCTTTGCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007944.3-2794s21c1
Sequence:CCGGCATCCCTTCAAGTTGTGCCATCTCGAGATGGCACAACTTGAAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-152s21c1
Sequence:CCGGGCTGCGCTGTTTCTGAAGAAACTCGAGTTTCTTCAGAAACAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-851s21c1
Sequence:CCGGGCAGATAAGATGCGCTTTGATCTCGAGATCAAAGCGCATCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-73s21c1
Sequence:CCGGTCCCGGTGGAAATCCGTTATACTCGAGTATAACGGATTTCCACCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007944
VALIDATED
EPS15L1 MISSION shRNA shRNA Plasmid DNA
epidermal growth factor receptor pathway substrate 15-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007944.1-2781s1c1
Sequence:CCGGCATCCCTTCAAGTTGTGCCATCTCGAGATGGCACAACTTGAAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007944.1-838s1c1
Sequence:CCGGGCAGATAAGATGCGCTTTGATCTCGAGATCAAAGCGCATCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007944.1-1440s1c1
Sequence:CCGGCCAGACAATCTCATCATTGAACTCGAGTTCAATGATGAGATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007944.1-139s1c1
Sequence:CCGGGCTGCGCTGTTTCTGAAGAAACTCGAGTTTCTTCAGAAACAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007944.1-2113s1c1
Sequence:CCGGCCTTCAAAGCTCGACCCATTTCTCGAGAAATGGGTCGAGCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-2535s21c1
Sequence:CCGGTTAGTGGCAAAGATCCATTTGCTCGAGCAAATGGATCTTTGCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007944.3-2794s21c1
Sequence:CCGGCATCCCTTCAAGTTGTGCCATCTCGAGATGGCACAACTTGAAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-152s21c1
Sequence:CCGGGCTGCGCTGTTTCTGAAGAAACTCGAGTTTCTTCAGAAACAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-851s21c1
Sequence:CCGGGCAGATAAGATGCGCTTTGATCTCGAGATCAAAGCGCATCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-73s21c1
Sequence:CCGGTCCCGGTGGAAATCCGTTATACTCGAGTATAACGGATTTCCACCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007944
VALIDATED
EPS15L1 MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor receptor pathway substrate 15-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007944.1-2781s1c1
Sequence:CCGGCATCCCTTCAAGTTGTGCCATCTCGAGATGGCACAACTTGAAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007944.1-838s1c1
Sequence:CCGGGCAGATAAGATGCGCTTTGATCTCGAGATCAAAGCGCATCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007944.1-1440s1c1
Sequence:CCGGCCAGACAATCTCATCATTGAACTCGAGTTCAATGATGAGATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007944.1-139s1c1
Sequence:CCGGGCTGCGCTGTTTCTGAAGAAACTCGAGTTTCTTCAGAAACAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007944.1-2113s1c1
Sequence:CCGGCCTTCAAAGCTCGACCCATTTCTCGAGAAATGGGTCGAGCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-2535s21c1
Sequence:CCGGTTAGTGGCAAAGATCCATTTGCTCGAGCAAATGGATCTTTGCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007944.3-2794s21c1
Sequence:CCGGCATCCCTTCAAGTTGTGCCATCTCGAGATGGCACAACTTGAAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-152s21c1
Sequence:CCGGGCTGCGCTGTTTCTGAAGAAACTCGAGTTTCTTCAGAAACAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-851s21c1
Sequence:CCGGGCAGATAAGATGCGCTTTGATCTCGAGATCAAAGCGCATCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007944.3-73s21c1
Sequence:CCGGTCCCGGTGGAAATCCGTTATACTCGAGTATAACGGATTTCCACCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021235
VALIDATED
EPS15L1 MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor receptor pathway substrate 15-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021235.1-1187s1c1
Sequence:CCGGCCCAGTTACAAAGAGAGAAATCTCGAGATTTCTCTCTTTGTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021235.1-1324s1c1
Sequence:CCGGGCTCAGAAACAGGATGCTCAACTCGAGTTGAGCATCCTGTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021235.1-264s1c1
Sequence:CCGGCCATGAAGTTACCTTGAGCAACTCGAGTTGCTCAAGGTAACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021235.1-162s1c1
Sequence:CCGGCCTTGGGAAGATATGGGACTTCTCGAGAAGTCCCATATCTTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_021235.1-1880s1c1
Sequence:CCGGCCTTCAAATCTGACCCATTTACTCGAGTAAATGGGTCAGATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-294s21c1
Sequence:CCGGGAGCATGCCACCGCCTAAATTCTCGAGAATTTAGGCGGTGGCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-140s21c1
Sequence:CCGGAGTCTGGCCTCTCGGACATTACTCGAGTAATGTCCGAGAGGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021235.1-55s21c1
Sequence:CCGGTCGTTGTATGAATCTTATTACCTCGAGGTAATAAGATTCATACAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-1961s21c1
Sequence:CCGGCAACTTCAACAGATCCATTTGCTCGAGCAAATGGATCTGTTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-1605s21c1
Sequence:CCGGGAAGTCAACGCAAGACGAAATCTCGAGATTTCGTCTTGCGTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021235
VALIDATED
EPS15L1 MISSION shRNA shRNA Plasmid DNA
epidermal growth factor receptor pathway substrate 15-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021235.1-1187s1c1
Sequence:CCGGCCCAGTTACAAAGAGAGAAATCTCGAGATTTCTCTCTTTGTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021235.1-1324s1c1
Sequence:CCGGGCTCAGAAACAGGATGCTCAACTCGAGTTGAGCATCCTGTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021235.1-264s1c1
Sequence:CCGGCCATGAAGTTACCTTGAGCAACTCGAGTTGCTCAAGGTAACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021235.1-162s1c1
Sequence:CCGGCCTTGGGAAGATATGGGACTTCTCGAGAAGTCCCATATCTTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_021235.1-1880s1c1
Sequence:CCGGCCTTCAAATCTGACCCATTTACTCGAGTAAATGGGTCAGATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-294s21c1
Sequence:CCGGGAGCATGCCACCGCCTAAATTCTCGAGAATTTAGGCGGTGGCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-140s21c1
Sequence:CCGGAGTCTGGCCTCTCGGACATTACTCGAGTAATGTCCGAGAGGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021235.1-55s21c1
Sequence:CCGGTCGTTGTATGAATCTTATTACCTCGAGGTAATAAGATTCATACAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-1961s21c1
Sequence:CCGGCAACTTCAACAGATCCATTTGCTCGAGCAAATGGATCTGTTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-1605s21c1
Sequence:CCGGGAAGTCAACGCAAGACGAAATCTCGAGATTTCGTCTTGCGTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021235
VALIDATED
EPS15L1 MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor receptor pathway substrate 15-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021235.1-1187s1c1
Sequence:CCGGCCCAGTTACAAAGAGAGAAATCTCGAGATTTCTCTCTTTGTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021235.1-1324s1c1
Sequence:CCGGGCTCAGAAACAGGATGCTCAACTCGAGTTGAGCATCCTGTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021235.1-264s1c1
Sequence:CCGGCCATGAAGTTACCTTGAGCAACTCGAGTTGCTCAAGGTAACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_021235.1-162s1c1
Sequence:CCGGCCTTGGGAAGATATGGGACTTCTCGAGAAGTCCCATATCTTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_021235.1-1880s1c1
Sequence:CCGGCCTTCAAATCTGACCCATTTACTCGAGTAAATGGGTCAGATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-294s21c1
Sequence:CCGGGAGCATGCCACCGCCTAAATTCTCGAGAATTTAGGCGGTGGCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-140s21c1
Sequence:CCGGAGTCTGGCCTCTCGGACATTACTCGAGTAATGTCCGAGAGGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021235.1-55s21c1
Sequence:CCGGTCGTTGTATGAATCTTATTACCTCGAGGTAATAAGATTCATACAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-1961s21c1
Sequence:CCGGCAACTTCAACAGATCCATTTGCTCGAGCAAATGGATCTGTTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021235.1-1605s21c1
Sequence:CCGGGAAGTCAACGCAAGACGAAATCTCGAGATTTCGTCTTGCGTTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks