EMAIL THIS PAGE TO A FRIEND

EPS8L1

EPS8-like 1

88 Gene Product Result for
Synonyms: DRC3 EPS8R1
Gene ID:
Human(54869) Summary: This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67425) EPS8-like 1
Rat(361503) EPS8-like 1
sheep(101122621) EPS8-like 1
Zebrafish(503735) eps8-like1
dog(484302) EPS8-like 1
cow(514504) EPS8-like 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017729 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034951 MISSION® esiRNA esiRNA targeting mouse Eps8l1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017729 Rosetta Predictions human pricing
NM_133180 Rosetta Predictions human pricing
NM_139204 Rosetta Predictions human pricing
NM_001108467 Rosetta Predictions rat pricing
NM_026146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350505 predicted 1137
2 SASI_Hs02_00350506 predicted 863
3 SASI_Hs02_00350507 predicted 1089
4 SASI_Hs02_00350508 predicted 742
5 SASI_Hs02_00350509 predicted 962
6 SASI_Hs02_00350510 predicted 1026
7 SASI_Hs02_00350511 predicted 1825
8 SASI_Hs02_00350512 predicted 525
9 SASI_Hs02_00350513 predicted 516
10 SASI_Hs02_00350514 predicted 818
11 SASI_Hs01_00076772 predicted 677
12 SASI_Hs01_00076773 predicted 750
13 SASI_Hs01_00076774 predicted 830
14 SASI_Hs01_00076775 predicted 832
15 SASI_Hs01_00076776 predicted 769
16 SASI_Hs01_00076777 predicted 510
17 SASI_Hs01_00076778 predicted 677
18 SASI_Hs01_00076779 predicted 752
19 SASI_Hs01_00076780 predicted 488
20 SASI_Hs01_00076781 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362951 predicted 1520
2 SASI_Hs02_00362952 predicted 1248
3 SASI_Hs02_00362953 predicted 1476
4 SASI_Hs02_00362954 predicted 1131
5 SASI_Hs02_00362955 predicted 1342
6 SASI_Hs02_00362956 predicted 1415
7 SASI_Hs02_00362957 predicted 2216
8 SASI_Hs02_00362958 predicted 906
9 SASI_Hs02_00362959 predicted 896
10 SASI_Hs02_00362960 predicted 1196
11 SASI_Hs01_00075692 predicted 994
12 SASI_Hs01_00075693 predicted 1070
13 SASI_Hs01_00075694 predicted 1150
14 SASI_Hs01_00075695 predicted 1151
15 SASI_Hs01_00075696 predicted 1092
16 SASI_Hs01_00075697 predicted 826
17 SASI_Hs01_00075698 predicted 993
18 SASI_Hs01_00075699 predicted 1070
19 SASI_Hs01_00075700 predicted 810
20 SASI_Hs01_00075701 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108776 predicted 1080
2 SASI_Hs01_00108777 predicted 1151
3 SASI_Hs01_00108778 predicted 1232
4 SASI_Hs01_00108779 predicted 1232
5 SASI_Hs01_00108780 predicted 1179
6 SASI_Hs01_00108781 predicted 914
7 SASI_Hs01_00108782 predicted 1078
8 SASI_Hs01_00108783 predicted 1149
9 SASI_Hs01_00108784 predicted 888
10 SASI_Hs01_00108785 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238929 predicted 1378
2 SASI_Rn02_00238930 predicted 704
3 SASI_Rn02_00238931 predicted 1287
4 SASI_Rn02_00238932 predicted 2281
5 SASI_Rn02_00238933 predicted 430
6 SASI_Rn02_00238934 predicted 1712
7 SASI_Rn02_00238935 predicted 201
8 SASI_Rn02_00238936 predicted 214
9 SASI_Rn02_00238937 predicted 1643
10 SASI_Rn02_00238938 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067477 predicted 2194
2 SASI_Mm01_00067479 predicted 1293
3 SASI_Mm01_00067480 predicted 279
4 SASI_Mm02_00329757 predicted 343
5 SASI_Mm01_00067481 predicted 299
6 SASI_Mm01_00067482 predicted 618
7 SASI_Mm01_00067483 predicted 1620
8 SASI_Mm01_00067484 predicted 1281
9 SASI_Mm01_00067485 predicted 1550
10 SASI_Mm01_00067486 predicted 1518
11 SASI_Mm01_00067478 predicted 1451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026146
EPS8L1 MISSION shRNA Bacterial Glycerol Stock
EPS8-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026146.2-2305s1c1
Sequence:CCGGCAGTGGCAGTAGATGCCATAACTCGAGTTATGGCATCTACTGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-104s1c1
Sequence:CCGGAGTCTATCTATGAACAGAGAACTCGAGTTCTCTGTTCATAGATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-1624s1c1
Sequence:CCGGGAGGGCTATGTACCCTATAATCTCGAGATTATAGGGTACATAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-94s1c1
Sequence:CCGGCCAAGTGCAAAGTCTATCTATCTCGAGATAGATAGACTTTGCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-301s1c1
Sequence:CCGGCCTAGTCAAGTCACTCTGCTTCTCGAGAAGCAGAGTGACTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026146
EPS8L1 MISSION shRNA shRNA Plasmid DNA
EPS8-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026146.2-2305s1c1
Sequence:CCGGCAGTGGCAGTAGATGCCATAACTCGAGTTATGGCATCTACTGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-104s1c1
Sequence:CCGGAGTCTATCTATGAACAGAGAACTCGAGTTCTCTGTTCATAGATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-1624s1c1
Sequence:CCGGGAGGGCTATGTACCCTATAATCTCGAGATTATAGGGTACATAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-94s1c1
Sequence:CCGGCCAAGTGCAAAGTCTATCTATCTCGAGATAGATAGACTTTGCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-301s1c1
Sequence:CCGGCCTAGTCAAGTCACTCTGCTTCTCGAGAAGCAGAGTGACTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026146
EPS8L1 MISSION shRNA Lentiviral Transduction Particles
EPS8-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026146.2-2305s1c1
Sequence:CCGGCAGTGGCAGTAGATGCCATAACTCGAGTTATGGCATCTACTGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-104s1c1
Sequence:CCGGAGTCTATCTATGAACAGAGAACTCGAGTTCTCTGTTCATAGATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-1624s1c1
Sequence:CCGGGAGGGCTATGTACCCTATAATCTCGAGATTATAGGGTACATAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-94s1c1
Sequence:CCGGCCAAGTGCAAAGTCTATCTATCTCGAGATAGATAGACTTTGCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026146.2-301s1c1
Sequence:CCGGCCTAGTCAAGTCACTCTGCTTCTCGAGAAGCAGAGTGACTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017729
EPS8L1 MISSION shRNA Bacterial Glycerol Stock
EPS8-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-1033s1c1
Sequence:CCGGGACCCAGTTGAGAAACAGCTACTCGAGTAGCTGTTTCTCAACTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-1870s1c1
Sequence:CCGGGAGGTGGAAATGGAGGTCATTCTCGAGAATGACCTCCATTTCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-517s1c1
Sequence:CCGGGACGACGTAGAGAGCTTTGTACTCGAGTACAAAGCTCTCTACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-774s1c1
Sequence:CCGGGCCTCTGCAGATGATTGTGAACTCGAGTTCACAATCATCTGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-1170s1c1
Sequence:CCGGCCTGTGTAATTATGACTTCCACTCGAGTGGAAGTCATAATTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017729.3-1240s21c1
Sequence:CCGGGTCCTGGATGACAGTCGTAAGCTCGAGCTTACGACTGTCATCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017729.3-674s21c1
Sequence:CCGGACGTGCTGCAGAAGATCAAGTCTCGAGACTTGATCTTCTGCAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017729
EPS8L1 MISSION shRNA shRNA Plasmid DNA
EPS8-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-1033s1c1
Sequence:CCGGGACCCAGTTGAGAAACAGCTACTCGAGTAGCTGTTTCTCAACTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-1870s1c1
Sequence:CCGGGAGGTGGAAATGGAGGTCATTCTCGAGAATGACCTCCATTTCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-517s1c1
Sequence:CCGGGACGACGTAGAGAGCTTTGTACTCGAGTACAAAGCTCTCTACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-774s1c1
Sequence:CCGGGCCTCTGCAGATGATTGTGAACTCGAGTTCACAATCATCTGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-1170s1c1
Sequence:CCGGCCTGTGTAATTATGACTTCCACTCGAGTGGAAGTCATAATTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017729.3-1240s21c1
Sequence:CCGGGTCCTGGATGACAGTCGTAAGCTCGAGCTTACGACTGTCATCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017729.3-674s21c1
Sequence:CCGGACGTGCTGCAGAAGATCAAGTCTCGAGACTTGATCTTCTGCAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017729
EPS8L1 MISSION shRNA Lentiviral Transduction Particles
EPS8-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-1033s1c1
Sequence:CCGGGACCCAGTTGAGAAACAGCTACTCGAGTAGCTGTTTCTCAACTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-1870s1c1
Sequence:CCGGGAGGTGGAAATGGAGGTCATTCTCGAGAATGACCTCCATTTCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-517s1c1
Sequence:CCGGGACGACGTAGAGAGCTTTGTACTCGAGTACAAAGCTCTCTACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-774s1c1
Sequence:CCGGGCCTCTGCAGATGATTGTGAACTCGAGTTCACAATCATCTGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017729.2-1170s1c1
Sequence:CCGGCCTGTGTAATTATGACTTCCACTCGAGTGGAAGTCATAATTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017729.3-1240s21c1
Sequence:CCGGGTCCTGGATGACAGTCGTAAGCTCGAGCTTACGACTGTCATCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017729.3-674s21c1
Sequence:CCGGACGTGCTGCAGAAGATCAAGTCTCGAGACTTGATCTTCTGCAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks